LXL04_036900 | RubberDandelionOmics

Gene overview

LXL04_036900

Reference: OH-1004 Chr: Chr08 Coordinates: 49910835-49912827 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

939 bp · LXL04_036900|LXL04_036900|OH1004|cDNA

ATGGCGATTGGTGGAAATTCGTTTGAAGTCAATCCCGAGACAGAGAAGTTTCTTTGCGAGCGATTGTTGGACCAAACGCAGCCAATTTCGGAGCGATTCAGAGTCCTCTTCTCTCTCCGGAATCTTCGAGGCCCTGCCCCTCGCAATGCTCTAATCCTTGCAACAAAAGACTCTTCAAACCTACTGGCACATGAGGCTGCATTTGCTTTAGGTCAAATGCAAGATGCTGAAGCAATTCCTGCTTTAAAGCTTGTTCTTAA...

CDS

Download CDS FASTA

939 bp · LXL04_036900|LXL04_036900|OH1004|CDS

ATGGCGATTGGTGGAAATTCGTTTGAAGTCAATCCCGAGACAGAGAAGTTTCTTTGCGAGCGATTGTTGGACCAAACGCAGCCAATTTCGGAGCGATTCAGAGTCCTCTTCTCTCTCCGGAATCTTCGAGGCCCTGCCCCTCGCAATGCTCTAATCCTTGCAACAAAAGACTCTTCAAACCTACTGGCACATGAGGCTGCATTTGCTTTAGGTCAAATGCAAGATGCTGAAGCAATTCCTGCTTTAAAGCTTGTTCTTAA...

Protein

Download Protein FASTA

312 aa · LXL04_036900|LXL04_036900|OH1004|PROTEIN

MAIGGNSFEVNPETEKFLCERLLDQTQPISERFRVLFSLRNLRGPAPRNALILATKDSSNLLAHEAAFALGQMQDAEAIPALKLVLNDLSLHPIVRHEAAEALGAIGLESNIALLNDCLDSDPAQEVRETCELALARIQELKNINGSHQSSTPSPFLSVDPAAPASCSSVQDLRELILNEEKGMYERYGALFGLRNHGGDEAVAAIVASLNAKSALLRHEVAYVLGQLQNKCASDALSRVLKDVNEHPMVRHEAAEALGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036900`
TK1151 ID	TkA04G018040
OH-1004 ID	LXL04_036900
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036900

Location Chr08:49910835-49912827 (-)

Description Similar to At3g58180: Deoxyhypusine hydroxylase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58180`	Catalyzes the hydroxylation of the N(6)-(4-aminobutyl)-L-lysine intermediate to form hypusine, an essential post-translational modification only found in mature eIF-5A factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0626100`	Catalyzes the hydroxylation of the N(6)-(4-aminobutyl)-L-lysine intermediate to form hypusine, an essential post-translational modification only found in mature eIF-5A factor.	No verified direct reference in this release
`Os12g0163300`	Catalyzes the hydroxylation of the N(6)-(4-aminobutyl)-L-lysine intermediate to form hypusine, an essential post-translational modification only found in mature eIF-5A factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036900 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0008612 peptidyl-lysine modification to peptidyl-hypusine Biological Process

GO:0005506 iron ion binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0019135 deoxyhypusine monooxygenase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G58180

dosa:Os12g0163300

rno:314644

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.685

Rank 1 · LXL04_036900 · OH-1004

Nucleus0.528

Rank 2 · LXL04_036900 · OH-1004

Mitochondrion0.085

Rank 3 · LXL04_036900 · OH-1004

Cell membrane0.032

Rank 4 · LXL04_036900 · OH-1004

Peroxisome0.029

Rank 5 · LXL04_036900 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13646.13HEAT_217-86 aa

PF13646.13HEAT_251-136 aa

PF03130.23HEAT_PBS63-88 aa

PF29232.1HEAT_spiro63-136 aa

PF13646.13HEAT_2185-243 aa

PF13646.13HEAT_2205-289 aa

PF29232.1HEAT_spiro218-292 aa

PF03130.23HEAT_PBS250-276 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036900	`PF13646.13`	HEAT_2	17	86	5e-32	110.8
LXL04_036900	`PF13646.13`	HEAT_2	51	136	5e-32	110.8
LXL04_036900	`PF03130.23`	HEAT_PBS	63	88	1.2e-24	84.6
LXL04_036900	`PF29232.1`	HEAT_spiro	63	136	4.2e-22	79.3
LXL04_036900	`PF13646.13`	HEAT_2	185	243	5e-32	110.8
LXL04_036900	`PF13646.13`	HEAT_2	205	289	5e-32	110.8
LXL04_036900	`PF29232.1`	HEAT_spiro	218	292	4.2e-22	79.3
LXL04_036900	`PF03130.23`	HEAT_PBS	250	276	1.2e-24	84.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94JW0`	Arabidopsis thaliana	Deoxyhypusine hydroxylase	77.181%	Swiss-Prot	strong database homology
`Q2QLW3`	Oryza sativa subsp. japonica	Deoxyhypusine hydroxylase-B	75.503%	Swiss-Prot	strong database homology
`Q2QXB3`	Oryza sativa subsp. japonica	Deoxyhypusine hydroxylase-A	73.290%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card