LXL04_036593 | RubberDandelionOmics

Gene overview

LXL04_036593

Reference: OH-1004 Chr: Chr08 Coordinates: 45057088-45061948 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3652 bp · LXL04_036593|LXL04_036593|OH1004|cDNA

TGCAAATCCAAACCGTTGGTTTGCTTTGGTTTCGATTTCGTCgttttttttcgatttttcgATTTCTTGGTTCGGTTATTCATATTTGTTCGTGTAGCTAAACAAACGGAAAACAATGTTTATAATGTCGTTCCTTGGCTAAAGCTAAGGTTTTCTGTCCTCCACCGCCTTCCTCCAAGTCCAACTCCACAATCACTCGTTAAAAAATGAAACCTTTCTTTCTTCCACTGTTGAGAATTCTCTAGAACAGACTGCCAACG...

CDS

Download CDS FASTA

3498 bp · LXL04_036593|LXL04_036593|OH1004|CDS

CTGTCCTCCACCGCCTTCCTCCAAGTCCAACTCCACAATCACTCGTTAAAAAATGAAACCTTTCTTTCTTCCACTGTTGAGAATTCTCTAGAACAGACTGCCAACGACTCCTACAAAGCAAAGAACAAACTACAGCATCCAATTTCTCACGAATCTCTTCTCCAAGGTACCTTCAATCGCAGCTTTTTGCTTCATATGCTACCTAAGAAGCGACCTGCTGAAGTAATAAAGCTTGACGAAGATAGCAGTAGTGATAGTAT...

Protein

Download Protein FASTA

1165 aa · LXL04_036593|LXL04_036593|OH1004|PROTEIN

MSSTAFLQVQLHNHSLKNETFLSSTVENSLEQTANDSYKAKNKLQHPISHESLLQGTFNRSFLLHMLPKKRPAEVIKLDEDSSSDSITDNLHKRPRVGCLISSISSRTTTTGTTDCDRKENSGGQEFNNNSNSSSVAGNSVNASNMGFEDGNLQEIDEDLHSRQLAVYGRETMRRLFASNVLISGMQGLGAEIAKNLILAGVKSVTLHDEGAVELWDLSSNFLFSENDVGKNRALASVQKLQELNNAVLVSTLPSKLTKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036593`
TK1151 ID	TkA04G034880
OH-1004 ID	LXL04_036593
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 97.872 / OH-1004 51.330 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036593

Location Chr08:45057088-45061948 (-)

Description Similar to UBA1: Ubiquitin-activating enzyme E1 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30110`	Activates ubiquitin by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding a ubiquitin-E1 thioester and free AMP.	The ubiquitin pathway is required for innate immunity in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2006.02978.x The ubiquitin-activating enzyme (E1) gene family in Arabidopsis thaliana.1997 · DOI: 10.1046/j.1365-313x.1997.11020213.x
`At5g06460`	Activates ubiquitin by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding a ubiquitin-E1 thioester and free AMP.	The ubiquitin-activating enzyme (E1) gene family in Arabidopsis thaliana.1997 · DOI: 10.1046/j.1365-313x.1997.11020213.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036593 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006974 DNA damage response Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0051707 response to other organism Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0004839 ubiquitin activating enzyme activity Molecular Function

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT2G30110

ath:AT5G06460

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.607

Rank 1 · LXL04_036593 · OH-1004

Nucleus0.431

Rank 2 · LXL04_036593 · OH-1004

Mitochondrion0.083

Rank 3 · LXL04_036593 · OH-1004

Cell membrane0.055

Rank 4 · LXL04_036593 · OH-1004

Endoplasmic reticulum0.046

Rank 5 · LXL04_036593 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00899.28ThiF161-538 aa

PF16190.12E1_FCCH335-405 aa

PF16191.11E1_4HB407-476 aa

PF00899.28ThiF558-1052 aa

PF10585.15UBA_E1_SCCH747-1000 aa

PF09358.16E1_UFD1071-1160 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036593	`PF00899.28`	ThiF	161	538	7.3e-89	297.7
LXL04_036593	`PF16190.12`	E1_FCCH	335	405	1.1e-28	99.8
LXL04_036593	`PF16191.11`	E1_4HB	407	476	9.6e-25	87.1
LXL04_036593	`PF00899.28`	ThiF	558	1052	7.3e-89	297.7
LXL04_036593	`PF10585.15`	UBA_E1_SCCH	747	1000	2.4e-87	293.7
LXL04_036593	`PF09358.16`	E1_UFD	1071	1160	3.3e-26	92.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93028`	Arabidopsis thaliana	Ubiquitin-activating enzyme E1 1	79.805%	Swiss-Prot	strong database homology
`P92974`	Arabidopsis thaliana	Ubiquitin-activating enzyme E1 2	76.596%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card