LXL04_036467 | RubberDandelionOmics

Gene overview

LXL04_036467

Reference: OH-1004 Chr: Chr08 Coordinates: 42668984-42669595 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

612 bp · LXL04_036467|LXL04_036467|OH1004|cDNA

ATGGCTTCAAGTCCTACACAACCTCCTAGCTTACATCATTCATGGAGTCCAATAGTGATTGCTATTGTCGGCACCATGGGAACTCTATTTCTAGTTTTTAGTTACTTTAACATACTAAAACGCTGTTCATTTCGCGAATCGTCAAGAAATGGTCAAAGAAGGCGTTTACGTGGCACAATTCTTGATGGTAATAATGATCATTCCTTACAGTTCCAGAGCCGTGGACTTGATTCATTCGCTGTTCAAATGATTCCCGCAAC...

CDS

Download CDS FASTA

612 bp · LXL04_036467|LXL04_036467|OH1004|CDS

ATGGCTTCAAGTCCTACACAACCTCCTAGCTTACATCATTCATGGAGTCCAATAGTGATTGCTATTGTCGGCACCATGGGAACTCTATTTCTAGTTTTTAGTTACTTTAACATACTAAAACGCTGTTCATTTCGCGAATCGTCAAGAAATGGTCAAAGAAGGCGTTTACGTGGCACAATTCTTGATGGTAATAATGATCATTCCTTACAGTTCCAGAGCCGTGGACTTGATTCATTCGCTGTTCAAATGATTCCCGCAAC...

Protein

Download Protein FASTA

203 aa · LXL04_036467|LXL04_036467|OH1004|PROTEIN

MASSPTQPPSLHHSWSPIVIAIVGTMGTLFLVFSYFNILKRCSFRESSRNGQRRRLRGTILDGNNDHSLQFQSRGLDSFAVQMIPATQFKKKKESDKVINQCDESTECAICLGEYEDDEWVKTIPNCSHVFHVSCIDTWFQTHSSCPLCRSDIFDLEVSVSECRSRGNNLIGEAVDEERLVFYQTLRSHILQNSNFASLDHNL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036467`
TK1151 ID	TkA04G043220
OH-1004 ID	LXL04_036467
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036467

Location Chr08:42668984-42669595 (+)

Description Similar to ATL1: RING-H2 finger protein ATL1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g04360`	RING-H2 finger protein ATL1.	No verified direct reference in this release
`At5g43420`	RING-H2 finger protein ATL16.	No verified direct reference in this release
`At4g17905`	Putative RING-H2 finger protein ATL53.	No verified direct reference in this release
`At1g72200`	RING-H2 finger protein ATL11.	No verified direct reference in this release
`At4g40070`	RING-H2 finger protein ATL32.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036467 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G04360

ath:AT1G72200

ath:AT4G17905

ath:AT4G40070

ath:AT5G43420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.267

Rank 1 · LXL04_036467 · OH-1004

Cytoplasm0.254

Rank 2 · LXL04_036467 · OH-1004

Nucleus0.221

Rank 3 · LXL04_036467 · OH-1004

Lysosome / Vacuole0.218

Rank 4 · LXL04_036467 · OH-1004

Endoplasmic reticulum0.203

Rank 5 · LXL04_036467 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2107-150 aa

PF17123.12zf-RING_11107-136 aa

PF13923.13zf-C3HC4_2107-149 aa

PF12678.14zf-rbx1107-150 aa

PF00097.32zf-C3HC4108-149 aa

PF13445.13zf-RING_UBOX108-147 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036467	`PF13639.13`	zf-RING_2	107	150	1.1e-14	55.2
LXL04_036467	`PF17123.12`	zf-RING_11	107	136	5e-10	39.6
LXL04_036467	`PF13923.13`	zf-C3HC4_2	107	149	1.1e-09	38.6
LXL04_036467	`PF12678.14`	zf-rbx1	107	150	7.9e-09	36.3
LXL04_036467	`PF00097.32`	zf-C3HC4	108	149	1e-07	32.4
LXL04_036467	`PF13445.13`	zf-RING_UBOX	108	147	6.1e-06	26.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93823`	Arabidopsis thaliana	RING-H2 finger protein ATL1	37.500%	Swiss-Prot	moderate database homology
`Q9LSW9`	Arabidopsis thaliana	RING-H2 finger protein ATL16	33.125%	Swiss-Prot	moderate database homology
`P0C041`	Arabidopsis thaliana	Putative RING-H2 finger protein ATL53	33.108%	Swiss-Prot	moderate database homology
`Q84W40`	Arabidopsis thaliana	RING-H2 finger protein ATL11	31.469%	Swiss-Prot	moderate database homology
`Q8W571`	Arabidopsis thaliana	RING-H2 finger protein ATL32	35.333%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card