LXL04_036405 | RubberDandelionOmics

Gene overview

LXL04_036405

Reference: OH-1004 Chr: Chr08 Coordinates: 41387065-41388154 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

999 bp · LXL04_036405|LXL04_036405|OH1004|cDNA

ATGCCAACAGCGTCGTATTGGTGTTATCGATGCACACGCTTTGTCAGAGTAGCGGAAGCGGACACGGTTGTGTGCCCCCACTGCGAGGGAGGATTTATTGAAGTTGTGGAGGCCAACGCGCCGCCACGGCAGGACTTAAGGCGACGACTTCCAGCCGCTGCGATGTACATGCTCCGCAACAATGATCGGTCAGATCTGAGATTCAGGCGTCGTGGTAGACGTAACAACGGCGACTGGTCTCCTTTCAATCCGGTCATCGT...

CDS

Download CDS FASTA

999 bp · LXL04_036405|LXL04_036405|OH1004|CDS

ATGCCAACAGCGTCGTATTGGTGTTATCGATGCACACGCTTTGTCAGAGTAGCGGAAGCGGACACGGTTGTGTGCCCCCACTGCGAGGGAGGATTTATTGAAGTTGTGGAGGCCAACGCGCCGCCACGGCAGGACTTAAGGCGACGACTTCCAGCCGCTGCGATGTACATGCTCCGCAACAATGATCGGTCAGATCTGAGATTCAGGCGTCGTGGTAGACGTAACAACGGCGACTGGTCTCCTTTCAATCCGGTCATCGT...

Protein

Download Protein FASTA

332 aa · LXL04_036405|LXL04_036405|OH1004|PROTEIN

MPTASYWCYRCTRFVRVAEADTVVCPHCEGGFIEVVEANAPPRQDLRRRLPAAAMYMLRNNDRSDLRFRRRGRRNNGDWSPFNPVIVLRSVAEGAAGGMDEDSGGGESGFELYYDDGAGAGLQPLPAMMSEFLMGSGFDRLLEQLSQIDINGLSHSEQPPASKAAVESMPAIEVSNSHVSTESHCAICIEPFALGAEAREMPCKHIYHTDCILPWLTMRNSCPVCRHELPTDSTESSSSNLEHSEPNGEESPAVGLTIWR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036405`
TK1151 ID	TkA04G049650
OH-1004 ID	LXL04_036405
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	92.200
Protein coverage (%)	TK1151 82.730 / OH-1004 96.386 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036405

Location Chr08:41387065-41388154 (+)

Description Similar to DURF2: E3 ubiquitin-protein ligase RDUF2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g59550`	E3 ubiquitin-protein ligase involved in the positive regulation of abscisic acid-dependent drought stress responses.	Suppression of Arabidopsis RING-DUF1117 E3 ubiquitin ligases, AtRDUF1 and AtRDUF2, reduces tolerance to ABA-mediated drought stress.2012 · DOI: 10.1016/j.bbrc.2012.02.131
`At3g46620`	E3 ubiquitin-protein ligase involved in the positive regulation of abscisic acid-dependent drought stress responses.	Suppression of Arabidopsis RING-DUF1117 E3 ubiquitin ligases, AtRDUF1 and AtRDUF2, reduces tolerance to ABA-mediated drought stress.2012 · DOI: 10.1016/j.bbrc.2012.02.131 The E3 ligase AtRDUF1 positively regulates salt stress responses in Arabidopsis thaliana.2013 · DOI: 10.1371/journal.pone.0071078
`At2g39720`	Probable E3 ubiquitin-protein ligase that may possess E3 ubiquitin ligase activity in vitro.	No verified direct reference in this release
`At3g56580`	E3 ubiquitin-protein ligase that promotes osmotic stress and abscisic acid (ABA) responses.	The atrzf1 mutation of the novel RING-type E3 ubiquitin ligase increases proline contents and enhances drought tolerance in Arabidopsis.2013 · DOI: 10.1016/j.plantsci.2012.12.007 PCA22 acts as a suppressor of atrzf1 to mediate proline accumulation in response to abiotic stress in Arabidopsis.2017 · DOI: 10.1093/jxb/erx069

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036405 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0047484 regulation of response to osmotic stress Biological Process

GO:0051865 protein autoubiquitination Biological Process

GO:0090378 seed trichome elongation Biological Process

GO:1902006 negative regulation of L-proline biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G39720

ath:AT3G46620

ath:AT3G56580

ath:AT5G59550

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.583

Rank 1 · LXL04_036405 · OH-1004

Nucleus0.425

Rank 2 · LXL04_036405 · OH-1004

Endoplasmic reticulum0.095

Rank 3 · LXL04_036405 · OH-1004

Cell membrane0.088

Rank 4 · LXL04_036405 · OH-1004

Golgi apparatus0.063

Rank 5 · LXL04_036405 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14369.12Zn_ribbon_195-34 aa

PF13639.13zf-RING_2184-226 aa

PF12678.14zf-rbx1184-226 aa

PF17123.12zf-RING_11185-212 aa

PF13923.13zf-C3HC4_2185-225 aa

PF00097.32zf-C3HC4185-225 aa

PF06547.18DUF1117254-320 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036405	`PF14369.12`	Zn_ribbon_19	5	34	1.6e-12	48.0
LXL04_036405	`PF13639.13`	zf-RING_2	184	226	2.8e-13	50.6
LXL04_036405	`PF12678.14`	zf-rbx1	184	226	2.7e-06	28.2
LXL04_036405	`PF17123.12`	zf-RING_11	185	212	4.3e-08	33.4
LXL04_036405	`PF13923.13`	zf-C3HC4_2	185	225	3.4e-07	30.7
LXL04_036405	`PF00097.32`	zf-C3HC4	185	225	6.5e-06	26.6
LXL04_036405	`PF06547.18`	DUF1117	254	320	9.2e-26	91.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940T5`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RDUF2	48.624%	Swiss-Prot	moderate database homology
`Q9SNB6`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RDUF1	49.045%	Swiss-Prot	moderate database homology
`O22283`	Arabidopsis thaliana	Probable E3 ubiquitin-protein ligase RHC2A	44.444%	Swiss-Prot	moderate database homology
`Q94AK4`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RZF1	33.977%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card