LXL04_036396 | RubberDandelionOmics

Gene overview

LXL04_036396

Reference: OH-1004 Chr: Chr08 Coordinates: 41304735-41306289 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

930 bp · LXL04_036396|LXL04_036396|OH1004|cDNA

ATGTGTGACGCATTCAGCTCACCACCGTCTCTACTAATCCACAGAAAGCTTCGGATTTCAAGCTCCccaaatggttccactacttCAATAAAACCCTCATTTAGATCCAAGTACCTAAGCGTCCACGCCTCCATCAATCAAAACAATTCAAACAGATGGTCTCTTCAAGGGATGACAGCACTTGTTACTGGCGGAACCAGGGGAATTGGGCATGCGATTGTAGAGGAATTAGCTGGACATGGGGCGATTATCCACACATG...

CDS

Download CDS FASTA

930 bp · LXL04_036396|LXL04_036396|OH1004|CDS

ATGTGTGACGCATTCAGCTCACCACCGTCTCTACTAATCCACAGAAAGCTTCGGATTTCAAGCTCCCCAAATGGTTCCACTACTTCAATAAAACCCTCATTTAGATCCAAGTACCTAAGCGTCCACGCCTCCATCAATCAAAACAATTCAAACAGATGGTCTCTTCAAGGGATGACAGCACTTGTTACTGGCGGAACCAGGGGAATTGGGCATGCGATTGTAGAGGAATTAGCTGGACATGGGGCGATTATCCACACATG...

Protein

Download Protein FASTA

309 aa · LXL04_036396|LXL04_036396|OH1004|PROTEIN

MCDAFSSPPSLLIHRKLRISSSPNGSTTSIKPSFRSKYLSVHASINQNNSNRWSLQGMTALVTGGTRGIGHAIVEELAGHGAIIHTCARNESELNTCLKGWVDDGFEITGSVCDVSLQHDREQLMKEVSSLFDGKLHILVNNVGTNIRKPMVELTSKEFTTLMSTNFESVFHISQLAHPFLKASKSGSIVFTSSVSAFVSLKSMTLQGATKGAINQLTRNLACEWAKDGIRSNAVAPWYIKTSMVEQVLSNKSYVEEVLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036396`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036396

Location Chr08:41304735-41306289 (-)

Description Similar to At2g29260: Tropinone reductase homolog At2g29260, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g29260`	Tropinone reductase homolog At2g29260, chloroplastic.	No verified direct reference in this release
`At5g06060`	Tropinone reductase homolog At5g06060.	No verified direct reference in this release
`At2g29290`	Tropinone reductase homolog At2g29290.	No verified direct reference in this release
`At1g07440`	Tropinone reductase homolog At1g07440.	No verified direct reference in this release
`At2g29360`	Oxidoreductase active on cyclic ketones, but not on tropinone or nortropinone.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036396 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0046686 response to cadmium ion Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT1G07440

ath:AT2G29260

ath:AT2G29290

ath:AT2G29360

ath:AT5G06060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.935

Rank 1 · LXL04_036396 · OH-1004

Mitochondrion0.098

Rank 2 · LXL04_036396 · OH-1004

Cytoplasm0.031

Rank 3 · LXL04_036396 · OH-1004

Peroxisome0.019

Rank 4 · LXL04_036396 · OH-1004

Nucleus0.019

Rank 5 · LXL04_036396 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23441.1SDR56-299 aa

PF00106.32adh_short59-250 aa

PF08659.17KR59-230 aa

PF13561.13adh_short_C267-300 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036396	`PF23441.1`	SDR	56	299	8.7e-10	39.1
LXL04_036396	`PF00106.32`	adh_short	59	250	1.1e-48	166.0
LXL04_036396	`PF08659.17`	KR	59	230	2.9e-10	41.1
LXL04_036396	`PF13561.13`	adh_short_C2	67	300	1e-56	192.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZW12`	Arabidopsis thaliana	Tropinone reductase homolog At2g29260, chloroplastic	68.667%	Swiss-Prot	strong database homology
`Q9LHT0`	Arabidopsis thaliana	Tropinone reductase homolog At5g06060	66.798%	Swiss-Prot	strong database homology
`Q9ZW13`	Arabidopsis thaliana	Tropinone reductase homolog At2g29290	60.769%	Swiss-Prot	strong database homology
`P0DKI3`	Arabidopsis thaliana	Tropinone reductase homolog At1g07440	60.456%	Swiss-Prot	strong database homology
`Q9ZW19`	Arabidopsis thaliana	Tropinone reductase homolog At2g29360	61.660%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card