LXL04_034938 | RubberDandelionOmics

Gene overview

LXL04_034938

Reference: OH-1004 Chr: Chr08 Coordinates: 7103510-7106506 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1272 bp · LXL04_034938|LXL04_034938|OH1004|cDNA

atgTATAATGCGTACATTGATGGTATGATGAAGGGAAGAAATTCACAAAAAGGAAACGGTACCATTTTCCTAGCTGGCCCACCACTCGTGAAGGATACTCAAAATCCCTTGTATTTGCACAGGGATGCACACAAAAGCCCCTCTTATTGGTCGAGTGTTTGCTTGCATAATATGGCCAATTTGGCAAAGGAGGCAACAACTATTAGACTTGTACTTGAACCTCTTTTTCACAGTTTTGACACTGAAAAACATTGGTTCCC...

CDS

Download CDS FASTA

1272 bp · LXL04_034938|LXL04_034938|OH1004|CDS

ATGTATAATGCGTACATTGATGGTATGATGAAGGGAAGAAATTCACAAAAAGGAAACGGTACCATTTTCCTAGCTGGCCCACCACTCGTGAAGGATACTCAAAATCCCTTGTATTTGCACAGGGATGCACACAAAAGCCCCTCTTATTGGTCGAGTGTTTGCTTGCATAATATGGCCAATTTGGCAAAGGAGGCAACAACTATTAGACTTGTACTTGAACCTCTTTTTCACAGTTTTGACACTGAAAAACATTGGTTCCC...

Protein

Download Protein FASTA

423 aa · LXL04_034938|LXL04_034938|OH1004|PROTEIN

MYNAYIDGMMKGRNSQKGNGTIFLAGPPLVKDTQNPLYLHRDAHKSPSYWSSVCLHNMANLAKEATTIRLVLEPLFHSFDTEKHWFPKKGLAFSILKYLQMVLEESDDKSHLLLSILIKHLELSQFVKQQASIPIVGAISDLIKHLRKCLQSLSEPSSPRVGPISCYMDLQSALEKCISSLLHKLSKMESSCGVRNSFSRDSSTPFEELQLYLQKQLQENLVNFEHLTKKATDAQFEKDKLLLKLESACDGKPWNETDSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034938`
TK1151 ID	TkA04G273740
OH-1004 ID	LXL04_034938
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 98.109 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034938

Location Chr08:7103510-7106506 (-)

Description Similar to KIN4C: Kinesin-like protein KIN-4C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60930`	Kinesin-like motor protein involved in the control of the oriented deposition of cellulose microfibrils.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B9F2Y7`	Microtubule-dependent motor protein involved in the control of the oriented deposition of cellulose microfibrils.	No verified direct reference in this release
`Os03g0308200`	Functions in regulating leaf rolling through abaxial side leaf cell differentiation.	Semi-Rolled Leaf2 modulates rice leaf rolling by regulating abaxial side cell differentiation.2016 · DOI: 10.1093/jxb/erw029

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034938 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0007052 mitotic spindle organization Biological Process

GO:0030154 cell differentiation Biological Process

GO:0051231 spindle elongation Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005874 microtubule Cellular Component

GO:0005875 microtubule associated complex Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0055028 cortical microtubule Cellular Component

KEGG gene cross-reference

ath:AT5G60930

dosa:Os02g0742800

dosa:Os02g0742900

dosa:Os03g0308200

osa:4332616

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.466

Rank 1 · LXL04_034938 · OH-1004

Cytoplasm0.390

Rank 2 · LXL04_034938 · OH-1004

Cell membrane0.128

Rank 3 · LXL04_034938 · OH-1004

Endoplasmic reticulum0.080

Rank 4 · LXL04_034938 · OH-1004

Golgi apparatus0.062

Rank 5 · LXL04_034938 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21052.5EFR3_ARM33-147 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034938	`PF21052.5`	EFR3_ARM	33	147	5.1e-14	52.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K0J3`	Arabidopsis thaliana	Kinesin-like protein KIN-4C	45.098%	Swiss-Prot	weak database homology
`B9F2Y7`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-4C	37.241%	Swiss-Prot	weak database homology
`Q10MI0`	Oryza sativa subsp. japonica	Protein SEMI-ROLLED LEAF 2	28.750%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card