LXL04_033550 | RubberDandelionOmics

Gene overview

LXL04_033550

Reference: OH-1004 Chr: Chr07 Coordinates: 47533837-47535989 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

777 bp · LXL04_033550|LXL04_033550|OH1004|cDNA

ATGCACAGAGACCACCCGAGAGAGAGACCACCCGGAAGAGAAGCCGGACCTGGGCAGGGCTCGCATCGGAAGGCGGTGATCGACACAGCAACTGCTCCGATTCAACTTCGATCCGTCTCAGCACCACCGCTTCCCCACGTACGTCCATCCATCGACGACCTCCTCCATCTTCGCATCCCATCTCTTTCACGGCGTCACCCACCAGGCCACCAACATCAGCGCTTCCTCCTGCAGCGACGTCCTCCAATAGGTATAGATTT...

CDS

Download CDS FASTA

777 bp · LXL04_033550|LXL04_033550|OH1004|CDS

ATGCACAGAGACCACCCGAGAGAGAGACCACCCGGAAGAGAAGCCGGACCTGGGCAGGGCTCGCATCGGAAGGCGGTGATCGACACAGCAACTGCTCCGATTCAACTTCGATCCGTCTCAGCACCACCGCTTCCCCACGTACGTCCATCCATCGACGACCTCCTCCATCTTCGCATCCCATCTCTTTCACGGCGTCACCCACCAGGCCACCAACATCAGCGCTTCCTCCTGCAGCGACGTCCTCCAATAGGTATAGATTT...

Protein

Download Protein FASTA

258 aa · LXL04_033550|LXL04_033550|OH1004|PROTEIN

MHRDHPRERPPGREAGPGQGSHRKAVIDTATAPIQLRSVSAPPLPHVRPSIDDLLHLRIPSLSRRHPPGHQHQRFLLQRRPPIGIDFAFEIDFATCQFEIDFASSEFEIDFATCEPEHYYLNLKSVFLPVNLLTSQIGLYASEFGSLPVSIYMLQEIDRMYLLFICFDLYGSLSYQITVMPSRTGYHNMYKEYRDTTLNGSIEQMCKRESTKQFHNCKIKFPLVFKKVRPPTRKLKTTYKAHRGQKQRYPPRPRLIPA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033550`
TK1151 ID	TkA08G273540
OH-1004 ID	LXL04_033550
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 95.804 / OH-1004 53.101 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033550

Location Chr07:47533837-47535989 (-)

Description Similar to RPL18AA: 60S ribosomal protein L18a-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29965`	Large ribosomal subunit protein eL20w.	No verified direct reference in this release
`At2g34480`	Large ribosomal subunit protein eL20y.	No verified direct reference in this release
`At3g14600`	Large ribosomal subunit protein eL20x.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0752300`	Large ribosomal subunit protein eL20.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033550 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0006412 translation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005840 ribosome Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

KEGG gene cross-reference

ath:AT1G29965

ath:AT2G34480

ath:AT3G14600

dosa:Os01g0752300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.413

Rank 1 · LXL04_033550 · OH-1004

Cytoplasm0.408

Rank 2 · LXL04_033550 · OH-1004

Mitochondrion0.149

Rank 3 · LXL04_033550 · OH-1004

Cell membrane0.106

Rank 4 · LXL04_033550 · OH-1004

Endoplasmic reticulum0.075

Rank 5 · LXL04_033550 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L7K0`	Arabidopsis thaliana	Large ribosomal subunit protein eL20w	61.798%	Swiss-Prot	weak database homology
`P51418`	Arabidopsis thaliana	Large ribosomal subunit protein eL20y	61.798%	Swiss-Prot	weak database homology
`Q9LUD4`	Arabidopsis thaliana	Large ribosomal subunit protein eL20x	60.674%	Swiss-Prot	weak database homology
`Q943F3`	Oryza sativa subsp. japonica	Large ribosomal subunit protein eL20	57.303%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card