LXL04_033524 | RubberDandelionOmics

Gene overview

LXL04_033524

Reference: OH-1004 Chr: Chr07 Coordinates: 46140310-46147491 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2280 bp · LXL04_033524|LXL04_033524|OH1004|cDNA

ATGGAGGTCGACGAAGGAGGAGCTCTCTTCCACTCCTCGATGGCTGCTGTTTCCACAGAAAACAGCGGCAACAAAAGGGTAGCCGGTGGCTGTTCGAGCAAAGGGAGAGGAAACCACGAGCTGCTGGGGGCTGTGCTGTCGCCGGAACAGCAACGAAGGTGGCCGGATAAGCTGTCGCCGAAGATTGTAGCACCGAATTTATCTCCGAAAAACGAGCGTTACAAGACTCTAGTTGCTACTTCGACAAACCACTCCGAACT...

CDS

Download CDS FASTA

2280 bp · LXL04_033524|LXL04_033524|OH1004|CDS

ATGGAGGTCGACGAAGGAGGAGCTCTCTTCCACTCCTCGATGGCTGCTGTTTCCACAGAAAACAGCGGCAACAAAAGGGTAGCCGGTGGCTGTTCGAGCAAAGGGAGAGGAAACCACGAGCTGCTGGGGGCTGTGCTGTCGCCGGAACAGCAACGAAGGTGGCCGGATAAGCTGTCGCCGAAGATTGTAGCACCGAATTTATCTCCGAAAAACGAGCGTTACAAGACTCTAGTTGCTACTTCGACAAACCACTCCGAACT...

Protein

Download Protein FASTA

759 aa · LXL04_033524|LXL04_033524|OH1004|PROTEIN

MEVDEGGALFHSSMAAVSTENSGNKRVAGGCSSKGRGNHELLGAVLSPEQQRRWPDKLSPKIVAPNLSPKNERYKTLVATSTNHSELLALYEATRECVWFRAVIGHIRSTCDLAYDPNKPVIIYEDNIAVIDQAKHGYIKGDNIKHISPKLFFTHEQQAFQKIEVQHIGSDKNHADLFTNHVASVTPTSNCESTKYQTFNVEVEPPHPHPNPPSSSSSSFSCRLFSLPIVQMAYLNAAAAASLSASAVLAPLNRTVVHWG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033524`
TK1151 ID	TkA08G270350
OH-1004 ID	LXL04_033524
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	98.100
Protein coverage (%)	TK1151 98.639 / OH-1004 76.416 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033524

Location Chr07:46140310-46147491 (-)

Description Similar to NDC1: Alternative NAD(P)H-ubiquinone oxidoreductase C1, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g08740`	Bifunctional oxidoreductase ables to act both on prenyl naphthoquinones and on prenyl benzoquinones.	Arabidopsis genes encoding mitochondrial type II NAD(P)H dehydrogenases have different evolutionary origin and show distinct responses to light.2003 · DOI: 10.1104/pp.103.024208 A Dedicated Type II NADPH Dehydrogenase Performs the Penultimate Step in the Biosynthesis of Vitamin K1 in Synechocystis and Arabidopsis.2015 · DOI: 10.1105/tpc.15.00103

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033524 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0019646 aerobic electron transport chain Biological Process

GO:0042372 phylloquinone biosynthetic process Biological Process

GO:0071482 cellular response to light stimulus Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0003955 NAD(P)H dehydrogenase (quinone) activity Molecular Function

GO:0008137 NADH dehydrogenase (ubiquinone) activity Molecular Function

KEGG gene cross-reference

ath:AT5G08740

bsu:BSU32100

hin:HI_0747

ssp:SSP1834

syn:slr1743

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.957

Rank 1 · LXL04_033524 · OH-1004

Mitochondrion0.059

Rank 2 · LXL04_033524 · OH-1004

Cytoplasm0.033

Rank 3 · LXL04_033524 · OH-1004

Nucleus0.021

Rank 4 · LXL04_033524 · OH-1004

Peroxisome0.020

Rank 5 · LXL04_033524 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07992.21Pyr_redox_2322-659 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033524	`PF07992.21`	Pyr_redox_2	322	659	1e-35	124.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GXR9`	Arabidopsis thaliana	Alternative NAD(P)H-ubiquinone oxidoreductase C1, chloroplastic/mitochondrial	73.491%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card