LXL04_033042 | RubberDandelionOmics

Gene overview

LXL04_033042

Reference: OH-1004 Chr: Chr07 Coordinates: 34934981-34939117 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2028 bp · LXL04_033042|LXL04_033042|OH1004|cDNA

ATGACGGAGGTAGCAAAATTGCTGTACATAGTGGTGGAGGAGGATGAAGAAACGAAAGGGAATGAAGAATCGTCATTTAGATACACGCGCCCTGTTCTTCAGAGCACTTTGCAGTTAATGGGATGTAAAGCACGTCACGCCTTCAAGCTAGATCTCCATGAATGGTACTGTCGCACCGAAAGTGATGTTTCACTCGGTTTACTTTTACCAGAAAGCGACTTGTCTAAAACCGTTGATTTCCAAATAAGCCAGAGAGTATT...

CDS

Download CDS FASTA

2028 bp · LXL04_033042|LXL04_033042|OH1004|CDS

ATGACGGAGGTAGCAAAATTGCTGTACATAGTGGTGGAGGAGGATGAAGAAACGAAAGGGAATGAAGAATCGTCATTTAGATACACGCGCCCTGTTCTTCAGAGCACTTTGCAGTTAATGGGATGTAAAGCACGTCACGCCTTCAAGCTAGATCTCCATGAATGGTACTGTCGCACCGAAAGTGATGTTTCACTCGGTTTACTTTTACCAGAAAGCGACTTGTCTAAAACCGTTGATTTCCAAATAAGCCAGAGAGTATT...

Protein

Download Protein FASTA

675 aa · LXL04_033042|LXL04_033042|OH1004|PROTEIN

MTEVAKLLYIVVEEDEETKGNEESSFRYTRPVLQSTLQLMGCKARHAFKLDLHEWYCRTESDVSLGLLLPESDLSKTVDFQISQRVFEIMRNKCLEDTLADIGVIQWGKDFFKVHPLSDKMNTSNHVISEKDGKPFESYKKRTTIVIKRSRFIDVVCDALSEYKYIGPNQRADFLLACRIRERKESVTVLLCGTSGCGKSTLSALLASRLGITTVISTDSIRHMMRSFVDEKQNPLLWSSTYHAGEHLDPVAVSEAKAKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033042`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033042

Location Chr07:34934981-34939117 (-)

Description Similar to At3g45090: P-loop NTPase domain-containing protein LPA1 homolog 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g45090`	May be not required for the accumulation of phytic acid in seeds.	Genetic analysis of two OsLpa1-like genes in Arabidopsis reveals that only one is required for wild-type seed phytic acid levels.2010 · DOI: 10.1007/s00425-010-1243-5
`At5g60760`	Required for the accumulation of phytic acid in seeds.	Genetic analysis of two OsLpa1-like genes in Arabidopsis reveals that only one is required for wild-type seed phytic acid levels.2010 · DOI: 10.1007/s00425-010-1243-5

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0819400`	Required for the accumulation of phytic acid in seeds.	The rice OsLpa1 gene encodes a novel protein involved in phytic acid metabolism.2008 · DOI: 10.1007/s00122-008-0818-z
`Os09g0572200`	Required for the accumulation of phytic acid in seeds.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033042 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010264 myo-inositol hexakisphosphate biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G45090

ath:AT5G60760

ddi:DDB_G0273453

ddi:DDB_G0273565

dosa:Os02g0819400

dosa:Os09g0572200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.440

Rank 1 · LXL04_033042 · OH-1004

Nucleus0.392

Rank 2 · LXL04_033042 · OH-1004

Cell membrane0.136

Rank 3 · LXL04_033042 · OH-1004

Golgi apparatus0.080

Rank 4 · LXL04_033042 · OH-1004

Endoplasmic reticulum0.073

Rank 5 · LXL04_033042 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28345.1LPA1_N10-50 aa

PF28345.1LPA1_N80-183 aa

PF13671.13AAA_33189-236 aa

PF13238.13AAA_18189-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033042	`PF28345.1`	LPA1_N	10	50	1.5e-48	165.3
LXL04_033042	`PF28345.1`	LPA1_N	80	183	1.5e-48	165.3
LXL04_033042	`PF13671.13`	AAA_33	189	236	4.8e-07	30.9
LXL04_033042	`PF13238.13`	AAA_18	189	233	2.8e-06	28.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93ZS1`	Arabidopsis thaliana	P-loop NTPase domain-containing protein LPA1 homolog 2	60.944%	Swiss-Prot	strong database homology
`Q9FJH9`	Arabidopsis thaliana	P-loop NTPase domain-containing protein LPA1 homolog 1	55.805%	Swiss-Prot	strong database homology
`B9F4I8`	Oryza sativa subsp. japonica	P-loop NTPase domain-containing protein LPA1	61.035%	Swiss-Prot	strong database homology
`Q651A1`	Oryza sativa subsp. japonica	P-loop NTPase domain-containing protein LPA1 homolog	55.589%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card