LXL04_032545 | RubberDandelionOmics

Gene overview

LXL04_032545

Reference: OH-1004 Chr: Chr07 Coordinates: 25050756-25056184 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2946 bp · LXL04_032545|LXL04_032545|OH1004|cDNA

ATGGGTTCACTTTATGGGACACATGAGATTGTTGAAATAAAGGATGATGAACCTAACTTGAGTGATTATCCCAGTCGTTTCCACCAATCAAGggcaaaagaaaaagaaaaagaaaaagaaaaagaaaaagaaaaagaaaaagagaaaaagcCTCAAGGGTACAGTAGATACATAGAAGAGGACATCAATAAGCTGTTTGAAGGTATCAATATCAGAACTTCATTCAACGGTTCCAGTTATTCAGATGAAACAGGTGTCTC...

CDS

Download CDS FASTA

2946 bp · LXL04_032545|LXL04_032545|OH1004|CDS

ATGGGTTCACTTTATGGGACACATGAGATTGTTGAAATAAAGGATGATGAACCTAACTTGAGTGATTATCCCAGTCGTTTCCACCAATCAAGGGCAAAAGAAAAAGAAAAAGAAAAAGAAAAAGAAAAAGAAAAAGAAAAAGAGAAAAAGCCTCAAGGGTACAGTAGATACATAGAAGAGGACATCAATAAGCTGTTTGAAGGTATCAATATCAGAACTTCATTCAACGGTTCCAGTTATTCAGATGAAACAGGTGTCTC...

Protein

Download Protein FASTA

981 aa · LXL04_032545|LXL04_032545|OH1004|PROTEIN

MGSLYGTHEIVEIKDDEPNLSDYPSRFHQSRAKEKEKEKEKEKEKEKEKKPQGYSRYIEEDINKLFEGINIRTSFNGSSYSDETGVSTPRKNPSKKPMRMSLSSSTSGIGIGYSEPKVSLKQALRGLCISQASEMAAIKRHSMPPGSPALSDSGKLTDFYKSVVKSNSNSNSNSRLSNQESTSTSKLPIPNMKSYSNSVQSSPRLTLEKSTKLVRPPQKLNEILLAPESESPEKNPIPIPPATSSESVNSVKPKSTPKSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032545`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032545

Location Chr07:25050756-25056184 (+)

Description Similar to KIPK1: Serine/threonine-protein kinase KIPK1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g52890`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390
`At2g36350`	Serine/threonine-protein kinase that could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At5g47750`	Protein kinase that regulates the auxin transport activity of PIN auxin efflux facilitators by direct phosphorylation.	D6PK AGCVIII kinases are required for auxin transport and phototropic hypocotyl bending in Arabidopsis.2013 · DOI: 10.1105/tpc.113.111484

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0291600`	May play a role in the regulation of metabolism and signal transduction processes.	No verified direct reference in this release
`UniProt: A2YBX5`	May play a role in the regulation of metabolism and signal transduction processes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032545 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0009638 phototropism Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010540 basipetal auxin transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016301 kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G36350

ath:AT3G52890

ath:AT5G47750

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.587

Rank 1 · LXL04_032545 · OH-1004

Nucleus0.298

Rank 2 · LXL04_032545 · OH-1004

Cell membrane0.181

Rank 3 · LXL04_032545 · OH-1004

Mitochondrion0.051

Rank 4 · LXL04_032545 · OH-1004

Golgi apparatus0.045

Rank 5 · LXL04_032545 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase397-546 aa

PF07714.24PK_Tyr_Ser-Thr398-546 aa

PF00069.32Pkinase624-727 aa

PF07714.24PK_Tyr_Ser-Thr630-716 aa

PF01125.23BUD31837-979 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032545	`PF00069.32`	Pkinase	397	546	6.4e-59	200.2
LXL04_032545	`PF07714.24`	PK_Tyr_Ser-Thr	398	546	1.9e-30	106.8
LXL04_032545	`PF00069.32`	Pkinase	624	727	6.4e-59	200.2
LXL04_032545	`PF07714.24`	PK_Tyr_Ser-Thr	630	716	1.9e-30	106.8
LXL04_032545	`PF01125.23`	BUD31	837	979	1.6e-62	210.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LFA2`	Arabidopsis thaliana	Serine/threonine-protein kinase KIPK1	70.991%	Swiss-Prot	weak database homology
`Q9SJM3`	Arabidopsis thaliana	Serine/threonine-protein kinase KIPK2	68.565%	Swiss-Prot	weak database homology
`Q39183`	Arabidopsis thaliana	Serine/threonine-protein kinase D6PKL2	61.521%	Swiss-Prot	weak database homology
`Q0DCT8`	Oryza sativa subsp. japonica	Protein kinase G11A	60.723%	Swiss-Prot	weak database homology
`A2YBX5`	Oryza sativa subsp. indica	Protein kinase G11A	60.723%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card