LXL04_032522 | RubberDandelionOmics

Gene overview

LXL04_032522

Reference: OH-1004 Chr: Chr07 Coordinates: 24716053-24717281 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1026 bp · LXL04_032522|LXL04_032522|OH1004|cDNA

ATGAAGTTCACTCTTTTCCACGTTTACACACTTCTTTCTGTATCACTTCTGGGATGTCGTGCAGTGACTCCCGAAGTTTACTGGAAGTCTCTGCTCCCAAACAGTCCAATGCCCAAATCAGTCAAAGATATTCTTGTGTCCACCGCAGAATGGACGGAAGAGAAATTCGCCATGGTCGGAGTTGGTGCCGGCGGTGTGGAGGTAGGCGCCGGAACACCCGGGGAACAAACGGAAGTCGGTGTCGGAAGAGGTGGAGTCGC...

CDS

Download CDS FASTA

1026 bp · LXL04_032522|LXL04_032522|OH1004|CDS

ATGAAGTTCACTCTTTTCCACGTTTACACACTTCTTTCTGTATCACTTCTGGGATGTCGTGCAGTGACTCCCGAAGTTTACTGGAAGTCTCTGCTCCCAAACAGTCCAATGCCCAAATCAGTCAAAGATATTCTTGTGTCCACCGCAGAATGGACGGAAGAGAAATTCGCCATGGTCGGAGTTGGTGCCGGCGGTGTGGAGGTAGGCGCCGGAACACCCGGGGAACAAACGGAAGTCGGTGTCGGAAGAGGTGGAGTCGC...

Protein

Download Protein FASTA

341 aa · LXL04_032522|LXL04_032522|OH1004|PROTEIN

MKFTLFHVYTLLSVSLLGCRAVTPEVYWKSLLPNSPMPKSVKDILVSTAEWTEEKFAMVGVGAGGVEVGAGTPGEQTEVGVGRGGVAVHTTHRGKPVCVGVHPGPDPFNYLYAASADQLKDDPNVALFFLENDLHQGGEMKLHFTKVDPSQKTTFLPRNIADSIPFSSNKLPQIYNKFSIKPESPEAEIMKQTLSECEKKGIEGEEKYCATSLESMVDFSTTKLGKKVKAISTEVNAKESRPLQKYKIEGAKKLVADKAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032522`
TK1151 ID	TkA08G184360
OH-1004 ID	LXL04_032522
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032522

Location Chr07:24716053-24717281 (-)

Description Similar to RD22: BURP domain protein RD22

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g25610`	Acts to suppress chlorophyll degradation under moisture stress.	AtRD22 and AtUSPL1, members of the plant-specific BURP domain family involved in Arabidopsis thaliana drought tolerance.2014 · DOI: 10.1371/journal.pone.0110065

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0733500`	BURP domain-containing protein 3.	No verified direct reference in this release
`Os04g0225700`	BURP domain-containing protein 5.	No verified direct reference in this release
`Os11g0170900`	BURP domain-containing protein 17.	No verified direct reference in this release
`Os05g0215066`	BURP domain-containing protein 6.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032522 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009651 response to salt stress Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT5G25610

dosa:Os01g0733500

dosa:Os04g0225700

dosa:Os05g0215066

dosa:Os11g0170900

osa:4335212

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.423

Rank 1 · LXL04_032522 · OH-1004

Extracellular0.345

Rank 2 · LXL04_032522 · OH-1004

Endoplasmic reticulum0.175

Rank 3 · LXL04_032522 · OH-1004

Cytoplasm0.170

Rank 4 · LXL04_032522 · OH-1004

Cell membrane0.078

Rank 5 · LXL04_032522 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03181.21BURP127-340 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032522	`PF03181.21`	BURP	127	340	1.2e-90	303.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q08298`	Arabidopsis thaliana	BURP domain protein RD22	50.134%	Swiss-Prot	strong database homology
`Q942D4`	Oryza sativa subsp. japonica	BURP domain-containing protein 3	59.127%	Swiss-Prot	strong database homology
`Q0JEP3`	Oryza sativa subsp. japonica	BURP domain-containing protein 5	42.857%	Swiss-Prot	moderate database homology
`B9G9L9`	Oryza sativa subsp. japonica	BURP domain-containing protein 17	51.304%	Swiss-Prot	moderate database homology
`Q6I5B2`	Oryza sativa subsp. japonica	BURP domain-containing protein 6	46.522%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card