LXL04_032111 | RubberDandelionOmics

Gene overview

LXL04_032111

Reference: OH-1004 Chr: Chr07 Coordinates: 16974328-16976852 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1575 bp · LXL04_032111|LXL04_032111|OH1004|cDNA

ATGGCAGGGACGTCGCTTGCAGGATTACAAGATCATTTGAAATTAGCGAGAGAATATGCACTCGAAGGCCTCTATGATACTTCCGTTATCTTCTTCGATGGCGCCATCGCTCAGATCAACAAGCACTTGAGCTCCCTTGATGATCCTCTGGCCCGATCAAAGTGGATGAACGTTAAAAAAGCTCTCACAGAGGAAACTGAAGTTGTAAAGCAATTGGATACCGAAAAGAGATCTTTCAAGGAAACTTCCATGGGTAGAAG...

CDS

Download CDS FASTA

1575 bp · LXL04_032111|LXL04_032111|OH1004|CDS

ATGGCAGGGACGTCGCTTGCAGGATTACAAGATCATTTGAAATTAGCGAGAGAATATGCACTCGAAGGCCTCTATGATACTTCCGTTATCTTCTTCGATGGCGCCATCGCTCAGATCAACAAGCACTTGAGCTCCCTTGATGATCCTCTGGCCCGATCAAAGTGGATGAACGTTAAAAAAGCTCTCACAGAGGAAACTGAAGTTGTAAAGCAATTGGATACCGAAAAGAGATCTTTCAAGGAAACTTCCATGGGTAGAAG...

Protein

Download Protein FASTA

524 aa · LXL04_032111|LXL04_032111|OH1004|PROTEIN

MAGTSLAGLQDHLKLAREYALEGLYDTSVIFFDGAIAQINKHLSSLDDPLARSKWMNVKKALTEETEVVKQLDTEKRSFKETSMGRRPSSPPIPTNKSSFVFEPLDEYPTSSGAPMDDPDVWRPPSRDTSNKRSGRGGATARKGPQDGAWARGSSTRGGTTARGGKAGASSRVNSGVRSSTTAKKGSGGSGKPNSTKDDPGNGDGEVHTSKHGQYEGPDHDLAAMLERDVLENTPGVRFEDVAGLSEAKRLLEEAVVLPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032111`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032111

Location Chr07:16974328-16976852 (-)

Description Similar to AAA1: Katanin p60 ATPase-containing subunit A1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80350`	Severs microtubules in vitro in an ATP-dependent manner.	BOTERO1 is required for normal orientation of cortical microtubules and anisotropic cell expansion in Arabidopsis.2001 · DOI: 10.1046/j.1365-313x.2001.00946.x Cell specification in the Arabidopsis root epidermis requires the activity of ECTOPIC ROOT HAIR 3--a katanin-p60 protein.2002 · DOI: 10.1242/dev.129.1.123 The Arabidopsis lue1 mutant defines a katanin p60 ortholog involved in hormonal control of microtubule orientation during cell growth.2003 · DOI: 10.1242/jcs.00274 KTN80 confers precision to microtubule severing by specific targeting of katanin complexes in plant cells.2017 · DOI: 10.15252/embj.201796823

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032111 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0009653 anatomical structure morphogenesis Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0010091 trichome branching Biological Process

GO:0010154 fruit development Biological Process

GO:0031122 cytoplasmic microtubule organization Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0051013 microtubule severing Biological Process

GO:0051211 anisotropic cell growth Biological Process

GO:0051301 cell division Biological Process

KEGG gene cross-reference

ath:AT1G80350

dre:492790

gga:421626

mcf:101864950

ocu:100328900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.689

Rank 1 · LXL04_032111 · OH-1004

Nucleus0.293

Rank 2 · LXL04_032111 · OH-1004

Cell membrane0.104

Rank 3 · LXL04_032111 · OH-1004

Endoplasmic reticulum0.055

Rank 4 · LXL04_032111 · OH-1004

Golgi apparatus0.054

Rank 5 · LXL04_032111 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21126.4KATNA1_MIT11-71 aa

PF00004.36AAA276-413 aa

PF17862.8AAA_lid_3435-478 aa

PF09336.17Vps4_C477-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032111	`PF21126.4`	KATNA1_MIT	11	71	7e-18	64.8
LXL04_032111	`PF00004.36`	AAA	276	413	2.6e-39	135.4
LXL04_032111	`PF17862.8`	AAA_lid_3	435	478	6e-14	52.0
LXL04_032111	`PF09336.17`	Vps4_C	477	522	3.1e-11	43.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SEX2`	Arabidopsis thaliana	Katanin p60 ATPase-containing subunit A1	80.843%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card