LXL04_031364 | RubberDandelionOmics

Gene overview

LXL04_031364

Reference: OH-1004 Chr: Chr07 Coordinates: 5012467-5014282 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

846 bp · LXL04_031364|LXL04_031364|OH1004|cDNA

ATGACTCAAGAGGCGGGTGGTCGCAATCGTAAGCGTAAGAGGAGAAACAACCACCCGAAAACTGAAACCTCCTCAATAAAGCAgacctccacctccaccgccgCTGCCAATTCGACAGTCAAACAACCGCCTTCAACCTGCACTGTATCTAAAACTACCCCAAAGCCATTATCTTTCCTCGAAAAGATGAAAGCTAAATTAGCAGGAGGACATTTTCGTATGATTAACGAGAAGCTTTATACCTGCTCTGGAGATGAAGC...

CDS

Download CDS FASTA

846 bp · LXL04_031364|LXL04_031364|OH1004|CDS

ATGACTCAAGAGGCGGGTGGTCGCAATCGTAAGCGTAAGAGGAGAAACAACCACCCGAAAACTGAAACCTCCTCAATAAAGCAGACCTCCACCTCCACCGCCGCTGCCAATTCGACAGTCAAACAACCGCCTTCAACCTGCACTGTATCTAAAACTACCCCAAAGCCATTATCTTTCCTCGAAAAGATGAAAGCTAAATTAGCAGGAGGACATTTTCGTATGATTAACGAGAAGCTTTATACCTGCTCTGGAGATGAAGC...

Protein

Download Protein FASTA

281 aa · LXL04_031364|LXL04_031364|OH1004|PROTEIN

MTQEAGGRNRKRKRRNNHPKTETSSIKQTSTSTAAANSTVKQPPSTCTVSKTTPKPLSFLEKMKAKLAGGHFRMINEKLYTCSGDEALNYFKDDPSLFNMYHTGYQEQMSRWPEQPVNIIIKWLKDHNSSLVVADFGCGDARLAKGVKNKVFSIDLVSKDPSVIACDMANTPLDSSTIDVAVFCLSLMGTNFPNYIQEAQRVLKPSGWLLIAEVKSRFDPNTGGADPDRFCQAVCELGFTSVSKDFSNKMFILLYFKKKP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031364`
TK1151 ID	TkA08G103130
OH-1004 ID	LXL04_031364
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031364

Location Chr07:5012467-5014282 (+)

Description Similar to At5g40530: Ribosomal RNA-processing protein 8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g40530`	Probable methyltransferase required to silence rDNA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031364 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000183 rDNA heterochromatin formation Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006364 rRNA processing Biological Process

GO:0031167 rRNA methylation Biological Process

GO:0032259 methylation Biological Process

GO:0042149 cellular response to glucose starvation Biological Process

GO:0042273 ribosomal large subunit biogenesis Biological Process

GO:0045786 negative regulation of cell cycle Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0046015 regulation of transcription by glucose Biological Process

GO:0097009 energy homeostasis Biological Process

GO:1903450 regulation of G1 to G0 transition Biological Process

KEGG gene cross-reference

ath:AT5G40530

hsa:23378

mmu:101867

rno:308911

spo:2543219

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.892

Rank 1 · LXL04_031364 · OH-1004

Cytoplasm0.192

Rank 2 · LXL04_031364 · OH-1004

Mitochondrion0.055

Rank 3 · LXL04_031364 · OH-1004

Cell membrane0.019

Rank 4 · LXL04_031364 · OH-1004

Endoplasmic reticulum0.010

Rank 5 · LXL04_031364 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05148.22Methyltransf_861-281 aa

PF08241.19Methyltransf_11135-211 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031364	`PF05148.22`	Methyltransf_8	61	281	4.2e-81	272.7
LXL04_031364	`PF08241.19`	Methyltransf_11	135	211	7.1e-07	30.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JC0`	Arabidopsis thaliana	Ribosomal RNA-processing protein 8	74.236%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card