LXL04_030948 | RubberDandelionOmics

Gene overview

LXL04_030948

Reference: OH-1004 Chr: Chr06 Coordinates: 125546278-125550828 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2610 bp · LXL04_030948|LXL04_030948|OH1004|cDNA

ATGGCGACAATTCCATGTACAGTTCAACTCATCTTCGCGAGTTCAGACACAAAACCCATGAACAATTCGACCCCAATTCTTCGTAAACTCAATTCACTGTTTATCGGAATGCGTAAAGGACTCGGCTTTTGCAGACCCACTTCAAGAATCGGACCTAGTAGTTGCGGTTCAAGAACAACCTGTTGGTTCAAATTCGGTAAAAATGGCGTCGATGCTGAAGGTGCTGGTATTTACGGCAGTCAATCTCGCGACGATTTTGA...

CDS

Download CDS FASTA

2610 bp · LXL04_030948|LXL04_030948|OH1004|CDS

ATGGCGACAATTCCATGTACAGTTCAACTCATCTTCGCGAGTTCAGACACAAAACCCATGAACAATTCGACCCCAATTCTTCGTAAACTCAATTCACTGTTTATCGGAATGCGTAAAGGACTCGGCTTTTGCAGACCCACTTCAAGAATCGGACCTAGTAGTTGCGGTTCAAGAACAACCTGTTGGTTCAAATTCGGTAAAAATGGCGTCGATGCTGAAGGTGCTGGTATTTACGGCAGTCAATCTCGCGACGATTTTGA...

Protein

Download Protein FASTA

869 aa · LXL04_030948|LXL04_030948|OH1004|PROTEIN

MATIPCTVQLIFASSDTKPMNNSTPILRKLNSLFIGMRKGLGFCRPTSRIGPSSCGSRTTCWFKFGKNGVDAEGAGIYGSQSRDDFDRDDVEQYFNYMGMLAVEGTYDKMEALLSQNIHPVDILLMMAASEGDKPKIEELLKAGAKYDVKDAGGKTALDKAQLELGSAFQFSNSNPSFFHNLYSFLPPPPPPPPISFAPAKPIITMVTKPTKPPSPPSSRSSSLSTHLAVVELKQRILTSLSRLSDRDTHQIAVEDLETV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030948`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030948

Location Chr06:125546278-125550828 (-)

Description Similar to TOR1: Microtubule-associated protein TORTIFOLIA1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27060`	Plant-specific microtubule-associated protein (MAP) that regulates the orientation of cortical microtubules and the direction of organ growth.	Arabidopsis SPIRAL2 promotes uninterrupted microtubule growth by suppressing the pause state of microtubule dynamics.2008 · DOI: 10.1242/jcs.030221
`At1g50890`	Plant-specific microtubule-associated protein (MAP) that regulates the orientation of cortical microtubules and the direction of organ growth.	Arabidopsis SPIRAL2 promotes uninterrupted microtubule growth by suppressing the pause state of microtubule dynamics.2008 · DOI: 10.1242/jcs.030221
`At1g50900`	Involved in the import of light-harvesting complex proteins (LHCP) and subsequent routing of these proteins to the chloroplast signal recognition particle (SRP) pathway.	The GDC1 gene encodes a novel ankyrin domain-containing protein that is essential for grana formation in Arabidopsis.2011 · DOI: 10.1104/pp.110.165589

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0520800`	Involved in the import of light-harvesting complex proteins (LHCP) and subsequent routing of these proteins to the chloroplast signal recognition particle (SRP) pathway.	No verified direct reference in this release
`UniProt: A2YLX7`	Involved in the import of light-harvesting complex proteins (LHCP) and subsequent routing of these proteins to the chloroplast signal recognition particle (SRP) pathway.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030948 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010031 circumnutation Biological Process

GO:0090391 granum assembly Biological Process

GO:0170002 halotropism Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0010005 cortical microtubule, transverse to long axis Cellular Component

GO:0055028 cortical microtubule Cellular Component

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT1G50890

ath:AT1G50900

ath:AT4G27060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.340

Rank 1 · LXL04_030948 · OH-1004

Plastid0.320

Rank 2 · LXL04_030948 · OH-1004

Nucleus0.311

Rank 3 · LXL04_030948 · OH-1004

Cell membrane0.125

Rank 4 · LXL04_030948 · OH-1004

Endoplasmic reticulum0.068

Rank 5 · LXL04_030948 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23271.2HEAT_GCN1223-339 aa

PF24714.2TOR1L1_N231-513 aa

PF24713.2TOR1L1_C734-860 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030948	`PF23271.2`	HEAT_GCN1	223	339	7.8e-06	26.8
LXL04_030948	`PF24714.2`	TOR1L1_N	231	513	7.5e-112	374.0
LXL04_030948	`PF24713.2`	TOR1L1_C	734	860	5.2e-49	166.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9T041`	Arabidopsis thaliana	Microtubule-associated protein TORTIFOLIA1	46.721%	Swiss-Prot	moderate database homology
`F4I6M4`	Arabidopsis thaliana	TORTIFOLIA1-like protein 1	45.848%	Swiss-Prot	moderate database homology
`Q8VY88`	Arabidopsis thaliana	Protein LHCP TRANSLOCATION DEFECT	78.626%	Swiss-Prot	weak database homology
`A3BKF2`	Oryza sativa subsp. japonica	Protein LHCP TRANSLOCATION DEFECT	63.636%	Swiss-Prot	weak database homology
`A2YLX7`	Oryza sativa subsp. indica	Protein LHCP TRANSLOCATION DEFECT	63.636%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card