LXL04_030037 | RubberDandelionOmics

Gene overview

LXL04_030037

Reference: OH-1004 Chr: Chr06 Coordinates: 106235839-106239864 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3336 bp · LXL04_030037|LXL04_030037|OH1004|cDNA

ATGGCTGCCACATCATCTGCAAGGTGGACCGATGGTCTCCGATTCTCATCGTTGTTTTGGCCTCCCCCTCTAGATACACATCAGCGCAAGGCACAAATTACCGCATATGTCGACTACTTTGGTAAATTTACATCAGAGCAATTTCCTGAAGATATAGCCGAGCTGGTTCGCCACCGCTACCCCTCACAGGAAAAACGCTTGTTCGATGATGTCTTAGCAACATTTGTCCTCCATCATCCAGAACACGGGCACAATGTCAT...

CDS

Download CDS FASTA

3336 bp · LXL04_030037|LXL04_030037|OH1004|CDS

ATGGCTGCCACATCATCTGCAAGGTGGACCGATGGTCTCCGATTCTCATCGTTGTTTTGGCCTCCCCCTCTAGATACACATCAGCGCAAGGCACAAATTACCGCATATGTCGACTACTTTGGTAAATTTACATCAGAGCAATTTCCTGAAGATATAGCCGAGCTGGTTCGCCACCGCTACCCCTCACAGGAAAAACGCTTGTTCGATGATGTCTTAGCAACATTTGTCCTCCATCATCCAGAACACGGGCACAATGTCAT...

Protein

Download Protein FASTA

1111 aa · LXL04_030037|LXL04_030037|OH1004|PROTEIN

MAATSSARWTDGLRFSSLFWPPPLDTHQRKAQITAYVDYFGKFTSEQFPEDIAELVRHRYPSQEKRLFDDVLATFVLHHPEHGHNVILPIISCIIDGTIEYNKSTPPFASFISLVCPTNDNEYSEQWALACGEILRILTHYNRPIFKAEHDRKRSGSQASTSNSDTGKTETGTGTERTTQNEVKPLRPLSPWITDILLAAPLGIRSDYFRWCGGVMGKYAGGELKPPSVMAATSRGSGKHPQLIPSTPRWAVANGAGVIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030037`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030037

Location Chr06:106235839-106239864 (+)

Description Similar to GI: Protein GIGANTEA

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22770`	Involved in regulation of circadian rhythm and photoperiodic flowering.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0182600`	Involved in regulation of circadian rhythm, and in the control of the photoperiodic flowering.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030037 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006950 response to stress Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009409 response to cold Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009637 response to blue light Biological Process

GO:0009908 flower development Biological Process

GO:0010218 response to far red light Biological Process

GO:0010378 temperature compensation of the circadian clock Biological Process

GO:0030154 cell differentiation Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0042752 regulation of circadian rhythm Biological Process

KEGG gene cross-reference

ath:AT1G22770

dosa:Os01g0182600

osa:4325329

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.457

Rank 1 · LXL04_030037 · OH-1004

Cytoplasm0.426

Rank 2 · LXL04_030037 · OH-1004

Cell membrane0.084

Rank 3 · LXL04_030037 · OH-1004

Golgi apparatus0.081

Rank 4 · LXL04_030037 · OH-1004

Endoplasmic reticulum0.072

Rank 5 · LXL04_030037 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30924.1GIGANTEA_N5-408 aa

PF30921.1GIGANTEA_M465-774 aa

PF28518.1GIGANTEA_C824-1108 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030037	`PF30924.1`	GIGANTEA_N	5	408	5.2e-237	787.0
LXL04_030037	`PF30921.1`	GIGANTEA_M	465	774	1.8e-159	531.3
LXL04_030037	`PF28518.1`	GIGANTEA_C	824	1108	2.9e-147	490.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SQI2`	Arabidopsis thaliana	Protein GIGANTEA	69.983%	Swiss-Prot	strong database homology
`Q9AWL7`	Oryza sativa subsp. japonica	Protein GIGANTEA	67.380%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card