LXL04_030023 | RubberDandelionOmics

Gene overview

LXL04_030023

Reference: OH-1004 Chr: Chr06 Coordinates: 105938819-105943799 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2352 bp · LXL04_030023|LXL04_030023|OH1004|cDNA

ATGCACTTTCAAAGAGTAAGTTCGTCTGCAATTCGTTATCGGCCTCCTGAGTTTTGCGATGTGTTAATCATTTCAGGCAAGATGATGGTCGAAGATCTAGGAATCGAAGCTAAGGAATCTGCAGTACGCGAGGTTGCGAAGCTCTTGCCGCTTCCTGAGCTTTTGCTATCCATTTCTTCAATCAAGGCAGATTACATTGCTCGGCAGCAGGCAACTGATGCACAGCTTAGCACTATGGTTGCTGAACAGGTTGAACAAGC...

CDS

Download CDS FASTA

2352 bp · LXL04_030023|LXL04_030023|OH1004|CDS

ATGCACTTTCAAAGAGTAAGTTCGTCTGCAATTCGTTATCGGCCTCCTGAGTTTTGCGATGTGTTAATCATTTCAGGCAAGATGATGGTCGAAGATCTAGGAATCGAAGCTAAGGAATCTGCAGTACGCGAGGTTGCGAAGCTCTTGCCGCTTCCTGAGCTTTTGCTATCCATTTCTTCAATCAAGGCAGATTACATTGCTCGGCAGCAGGCAACTGATGCACAGCTTAGCACTATGGTTGCTGAACAGGTTGAACAAGC...

Protein

Download Protein FASTA

783 aa · LXL04_030023|LXL04_030023|OH1004|PROTEIN

MHFQRVSSSAIRYRPPEFCDVLIISGKMMVEDLGIEAKESAVREVAKLLPLPELLLSISSIKADYIARQQATDAQLSTMVAEQVEQAQAGLKALGSSEKNVNQLRQNFVNIERLCQECQTLIENHDQIKLLSNARNNLNTTLKDVEGMMSISSEAAAAHDSLSDDKELINTYERLTALDGKRRFALAAASTHEEEVGRLRSYFEEVDRTWETFEQTLWSHISNFFQLAKESPQTLVRALRVVEMQEILDEQIAEEAAEAE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030023`
TK1151 ID	TkA07G371130
OH-1004 ID	LXL04_030023
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.300
Protein coverage (%)	TK1151 98.584 / OH-1004 91.826 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030023

Location Chr06:105938819-105943799 (-)

Description Similar to SEC6: Exocyst complex component SEC6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71820`	Component of the exocyst complex involved in the docking of exocytic vesicles with fusion sites on the plasma membrane during regulated or polarized secretion.	The Arabidopsis exocyst complex is involved in cytokinesis and cell plate maturation.2010 · DOI: 10.1105/tpc.110.074351 Visualization of the exocyst complex dynamics at the plasma membrane of Arabidopsis thaliana.2013 · DOI: 10.1091/mbc.e12-06-0492 Regulation of cytokinesis by exocyst subunit SEC6 and KEULE in Arabidopsis thaliana.2013 · DOI: 10.1093/mp/sst082

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030023 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0006887 exocytosis Biological Process

GO:0006904 vesicle docking involved in exocytosis Biological Process

GO:0007009 plasma membrane organization Biological Process

GO:0015031 protein transport Biological Process

GO:0016080 synaptic vesicle targeting Biological Process

GO:0016081 synaptic vesicle docking Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0032456 endocytic recycling Biological Process

GO:0043001 Golgi to plasma membrane protein transport Biological Process

GO:0051601 exocyst localization Biological Process

GO:0060321 acceptance of pollen Biological Process

KEGG gene cross-reference

ath:AT1G71820

bta:513138

cel:CELE_F09E5.5

ddi:DDB_G0293520

dme:Dmel_CG5341

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.621

Rank 1 · LXL04_030023 · OH-1004

Golgi apparatus0.258

Rank 2 · LXL04_030023 · OH-1004

Cell membrane0.223

Rank 3 · LXL04_030023 · OH-1004

Nucleus0.149

Rank 4 · LXL04_030023 · OH-1004

Lysosome / Vacuole0.129

Rank 5 · LXL04_030023 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06046.20Sec6203-734 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030023	`PF06046.20`	Sec6	203	734	1.1e-120	404.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AI6`	Arabidopsis thaliana	Exocyst complex component SEC6	82.540%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card