Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2553 bp · LXL04_029581|LXL04_029581|OH1004|cDNA
ATGGATCAAGGAGGACGTGCGTTTGTGTCGGCGTTGAGTGTGGGAATAGGAATAGGCGTTGGGCTTGGGGTGGGGAGGACGGTGAATCGTTTGGCCGCCGGCAATGATTCTTTAACAAACCCTGTCACGCCACAAATAATGGAGCGTGAGATGCTTGGTTTGATCATGGATGGCAGAGATAGCAAGGTTACTTTCTATGAATTTCCGTATTACCTCAGGCACACAAGGAATCTTGCTCCCGCAAGTCGAACCATATTGTT...
2553 bp · LXL04_029581|LXL04_029581|OH1004|CDS
ATGGATCAAGGAGGACGTGCGTTTGTGTCGGCGTTGAGTGTGGGAATAGGAATAGGCGTTGGGCTTGGGGTGGGGAGGACGGTGAATCGTTTGGCCGCCGGCAATGATTCTTTAACAAACCCTGTCACGCCACAAATAATGGAGCGTGAGATGCTTGGTTTGATCATGGATGGCAGAGATAGCAAGGTTACTTTCTATGAATTTCCGTATTACCTCAGGCACACAAGGAATCTTGCTCCCGCAAGTCGAACCATATTGTT...
Protein
Download Protein FASTA850 aa · LXL04_029581|LXL04_029581|OH1004|PROTEIN
MDQGGRAFVSALSVGIGIGVGLGVGRTVNRLAAGNDSLTNPVTPQIMEREMLGLIMDGRDSKVTFYEFPYYLRHTRNLAPASRTILLSGPAELYQQMLAKALAHYFEAKLLLLDVTDFSLKLQNKYGASAKPNSLKRSISETTLARMSGLFEGLSMIQPKPERKGGLRRQSSVADLGSNQPLQNPPNLRRNASTAANLDQFASNPVNPAPQSNWSFDEKLFVQTLYKVLTFTSNNSPVVFYLRDVEKFLGKSQRIYILFQ...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_029581 |
|---|---|
| TK1151 ID | TkA07G325950 |
| OH-1004 ID | LXL04_029581 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 94.900 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 89.294Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_029581 |
|---|---|
| Location | Chr06:94723816-94729796 (+) |
| Description | Similar to atad1a: ATPase family AAA domain-containing protein 1-A |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0001578 microtubule bundle formation Biological Process GO:0002092 positive regulation of receptor internalization Biological Process GO:0006626 protein targeting to mitochondrion Biological Process GO:0007019 microtubule depolymerization Biological Process GO:0009653 anatomical structure morphogenesis Biological Process GO:0031117 positive regulation of microtubule depolymerization Biological Process GO:0034214 protein hexamerization Biological Process GO:0045047 protein targeting to ER Biological Process GO:0051013 microtubule severing Biological Process GO:0051647 nucleus localization Biological Process GO:0090258 negative regulation of mitochondrial fission Biological Process GO:0140570 extraction of mislocalized protein from mitochondrial outer membrane Biological Process |
| KEGG gene cross-reference | cel:CELE_C24B5.2 mmu:67979 sce:YGR028W spo:2539116 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF24933.2DUF7751342-401 aaPF00004.36AAA508-638 aaPF17862.8AAA_lid_3662-705 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_029581 | PF24933.2 | DUF7751 | 342 | 401 | 5.5e-29 | 101.1 |
| LXL04_029581 | PF00004.36 | AAA | 508 | 638 | 9.8e-42 | 143.2 |
| LXL04_029581 | PF17862.8 | AAA_lid_3 | 662 | 705 | 3.7e-14 | 52.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.