LXL04_029452 | RubberDandelionOmics

Gene overview

LXL04_029452

Reference: OH-1004 Chr: Chr06 Coordinates: 90926799-90930812 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1464 bp · LXL04_029452|LXL04_029452|OH1004|cDNA

ATGTGGGTGGTGATAATGTCCGAGAGCTTTGCTTTCCTCTGTAATTTGGGTGTGATGGGGAAGACAAAGACGGGATCTGTTCTTGGATGCATAGGAAAGCTTGTTAATGGCGTTTTGAGCTTTTTTGTGTTTTCTGTACTCGATGTTCTTGATATTTTGTTGTGTTATGTGTACAAGATTATTGATTTTTTCATGGAAGATGAATGGAAGCCATGTTACTGTTCTTCACCGAAACAAACGATTATCAGTAGTGGTAACAT...

CDS

Download CDS FASTA

1464 bp · LXL04_029452|LXL04_029452|OH1004|CDS

ATGTGGGTGGTGATAATGTCCGAGAGCTTTGCTTTCCTCTGTAATTTGGGTGTGATGGGGAAGACAAAGACGGGATCTGTTCTTGGATGCATAGGAAAGCTTGTTAATGGCGTTTTGAGCTTTTTTGTGTTTTCTGTACTCGATGTTCTTGATATTTTGTTGTGTTATGTGTACAAGATTATTGATTTTTTCATGGAAGATGAATGGAAGCCATGTTACTGTTCTTCACCGAAACAAACGATTATCAGTAGTGGTAACAT...

Protein

Download Protein FASTA

487 aa · LXL04_029452|LXL04_029452|OH1004|PROTEIN

MWVVIMSESFAFLCNLGVMGKTKTGSVLGCIGKLVNGVLSFFVFSVLDVLDILLCYVYKIIDFFMEDEWKPCYCSSPKQTIISSGNILVSEKGEAEKILCLTSTKLHLEEISDTLYSRSSLAVEVSKTTVKRRNVVTSVNKAATVQSPFMVNTTIVEMLQEKIGGRHKPHRFPRWSDCDCDTCNSWSNSCKDTLFVHIGGRKDNVSENVLFIHGFISSSAFWTETLFPNFSKSIKSKYRLFAIDLLGFGKSPKPHDSLYT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029452`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029452

Location Chr06:90926799-90930812 (+)

Description Similar to BDG1: Probable lysophospholipase BODYGUARD 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64670`	Controls cuticle development and morphogenesis, by promoting cutin and suberin monomers loading.	The plant cuticle is required for osmotic stress regulation of abscisic acid biosynthesis and osmotic stress tolerance in Arabidopsis.2011 · DOI: 10.1105/tpc.110.081943
`At4g24140`	Involved in cuticle development and morphogenesis.	No verified direct reference in this release
`At5g41900`	Involved in cuticle development and morphogenesis.	No verified direct reference in this release
`At5g17720`	Involved in cuticle development and morphogenesis.	No verified direct reference in this release
`At5g17780`	Involved in cuticle development and morphogenesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029452 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009688 abscisic acid biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010115 regulation of abscisic acid biosynthetic process Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010148 transpiration Biological Process

GO:0010224 response to UV-B Biological Process

GO:0010345 suberin biosynthetic process Biological Process

GO:0048527 lateral root development Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0071555 cell wall organization Biological Process

GO:1901959 positive regulation of cutin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G64670

ath:AT4G24140

ath:AT5G17720

ath:AT5G17780

ath:AT5G41900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.302

Rank 1 · LXL04_029452 · OH-1004

Golgi apparatus0.174

Rank 2 · LXL04_029452 · OH-1004

Cell membrane0.155

Rank 3 · LXL04_029452 · OH-1004

Nucleus0.154

Rank 4 · LXL04_029452 · OH-1004

Cytoplasm0.139

Rank 5 · LXL04_029452 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12146.16Hydrolase_4206-462 aa

PF00561.27Abhydrolase_1209-465 aa

PF12697.14Abhydrolase_6209-474 aa

PF10230.16LIDHydrolase230-458 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029452	`PF12146.16`	Hydrolase_4	206	462	1.7e-12	47.9
LXL04_029452	`PF00561.27`	Abhydrolase_1	209	465	2.6e-29	103.3
LXL04_029452	`PF12697.14`	Abhydrolase_6	209	474	6e-15	57.2
LXL04_029452	`PF10230.16`	LIDHydrolase	230	458	3e-06	27.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LFX7`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 1	56.652%	Swiss-Prot	strong database homology
`O22977`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 3	53.924%	Swiss-Prot	strong database homology
`Q9FJ24`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 2	53.975%	Swiss-Prot	strong database homology
`Q9FN79`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 5	37.500%	Swiss-Prot	moderate database homology
`Q700D5`	Arabidopsis thaliana	Probable lysophospholipase BODYGUARD 4	37.744%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card