LXL04_029260 | RubberDandelionOmics

Gene overview

LXL04_029260

Reference: OH-1004 Chr: Chr06 Coordinates: 85252701-85254913 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1515 bp · LXL04_029260|LXL04_029260|OH1004|cDNA

ATGGGATCGAGCACCAGTAAATCTATTGATCCTGAAGCGGCGGTGACGCCTGTCGGCCGGTGGAGTTATTCGAGAAATGTGTTTCAAACTTCGTGTATGCGACCGGCATCTGGATCTTCCGATAGCAGCGACATTGACGATGACGAGGACATTGACAACCAACAGGTAACTAATCATCGCCCCAAAGAAAATGTTATCGAGGGCAATCGTTCAAGCACCAGTACATCAAAGTCAAAAGGTAAAACAGATCgaaacaaaaa...

CDS

Download CDS FASTA

1515 bp · LXL04_029260|LXL04_029260|OH1004|CDS

ATGGGATCGAGCACCAGTAAATCTATTGATCCTGAAGCGGCGGTGACGCCTGTCGGCCGGTGGAGTTATTCGAGAAATGTGTTTCAAACTTCGTGTATGCGACCGGCATCTGGATCTTCCGATAGCAGCGACATTGACGATGACGAGGACATTGACAACCAACAGGTAACTAATCATCGCCCCAAAGAAAATGTTATCGAGGGCAATCGTTCAAGCACCAGTACATCAAAGTCAAAAGGTAAAACAGATCGAAACAAAAA...

Protein

Download Protein FASTA

504 aa · LXL04_029260|LXL04_029260|OH1004|PROTEIN

MGSSTSKSIDPEAAVTPVGRWSYSRNVFQTSCMRPASGSSDSSDIDDDEDIDNQQVTNHRPKENVIEGNRSSTSTSKSKGKTDRNKNIKRKSTDKRERIPSSETHVGEWGESSLTASSSSSRFLSRFTFFPGNTSSRSSRAYPESSTSSIISNDENDLHSNHRTKTRVGCDPFPSCFMPRSHVPPHHDSDSDTDNNSDISSIHELHRDPNNNGSLFSPRNGHNNRRMEPREPVEQTVRFSRTLSVGRLRDRVVHNHRPIP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029260`
TK1151 ID	TkA07G292990
OH-1004 ID	LXL04_029260
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.100
Protein coverage (%)	TK1151 96.657 / OH-1004 63.095 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029260

Location Chr06:85252701-85254913 (+)

Description Similar to rnf149: E3 ubiquitin-protein ligase RNF149

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g11680`	Mediates E2-dependent protein ubiquitination in vitro.	No verified direct reference in this release
`At3g19950`	E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029260 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000578 embryonic axis specification Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016020 membrane Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

GO:0140297 DNA-binding transcription factor binding Molecular Function

KEGG gene cross-reference

ath:AT3G19950

ath:AT4G11680

xla:100137618

xla:431819

xtr:548845

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.400

Rank 1 · LXL04_029260 · OH-1004

Nucleus0.360

Rank 2 · LXL04_029260 · OH-1004

Cell membrane0.269

Rank 3 · LXL04_029260 · OH-1004

Endoplasmic reticulum0.079

Rank 4 · LXL04_029260 · OH-1004

Lysosome / Vacuole0.073

Rank 5 · LXL04_029260 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12678.14zf-rbx1444-488 aa

PF13639.13zf-RING_2445-488 aa

PF17123.12zf-RING_11445-473 aa

PF13923.13zf-C3HC4_2445-487 aa

PF00097.32zf-C3HC4446-487 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029260	`PF12678.14`	zf-rbx1	444	488	2.2e-08	34.9
LXL04_029260	`PF13639.13`	zf-RING_2	445	488	2.5e-13	50.7
LXL04_029260	`PF17123.12`	zf-RING_11	445	473	3.2e-09	37.0
LXL04_029260	`PF13923.13`	zf-C3HC4_2	445	487	3.6e-07	30.6
LXL04_029260	`PF00097.32`	zf-C3HC4	446	487	1e-08	35.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93Z92`	Arabidopsis thaliana	E3 ubiquitin-protein ligase At4g11680	56.140%	Swiss-Prot	weak database homology
`Q8LPN7`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RING1-like	36.364%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card