LXL04_026864 | RubberDandelionOmics

Gene overview

LXL04_026864

Reference: OH-1004 Chr: Chr06 Coordinates: 4112121-4115774 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1362 bp · LXL04_026864|LXL04_026864|OH1004|cDNA

ATGAATAGCAAGGAGAGTAGTAAAGACATTCAATTTCTACCTGCCCTCCTTCATTACCAAAAGAACAACAAGAAGTCAAGAACAGCCATCACTCATCACTCATCAGCCATGGCAACTTCCTTAAAGGTGGCGGTCATCGGCGCCGGTGTTTCCGGACTAGTCGCCGCCCGTGAGCTTCAACGAGAATCCCACCAAGTCATCGTATTTGAAAAATCCCACCAAATCGGCGGAACATGGGTCTACGATCCACGATTCGAGTC...

CDS

Download CDS FASTA

1362 bp · LXL04_026864|LXL04_026864|OH1004|CDS

ATGAATAGCAAGGAGAGTAGTAAAGACATTCAATTTCTACCTGCCCTCCTTCATTACCAAAAGAACAACAAGAAGTCAAGAACAGCCATCACTCATCACTCATCAGCCATGGCAACTTCCTTAAAGGTGGCGGTCATCGGCGCCGGTGTTTCCGGACTAGTCGCCGCCCGTGAGCTTCAACGAGAATCCCACCAAGTCATCGTATTTGAAAAATCCCACCAAATCGGCGGAACATGGGTCTACGATCCACGATTCGAGTC...

Protein

Download Protein FASTA

453 aa · LXL04_026864|LXL04_026864|OH1004|PROTEIN

MNSKESSKDIQFLPALLHYQKNNKKSRTAITHHSSAMATSLKVAVIGAGVSGLVAARELQRESHQVIVFEKSHQIGGTWVYDPRFESDLLGLDPNREIIHGSLYKSLRTNLPRQLMSFTDFDFSEKRYGDERLFPGHEEVLRFLEDFAGCFELTELIRFNTTVTRVEVVDSEVVEFEVESVANGRSTVEVFDAVVICTGHNSEPRPATDIPGIENWSKKQMHSHNYRVPGPFQDQIVVIIGNGPSALDLSRDIATVAKEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026864`
TK1151 ID	TkA07G012380
OH-1004 ID	LXL04_026864
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 92.053 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026864

Location Chr06:4112121-4115774 (-)

Description Similar to FMOGS-OX5: Flavin-containing monooxygenase FMO GS-OX5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12140`	Catalyzes the conversion of methylthioalkyl glucosinolates into methylsulfinylalkyl glucosinolates.	No verified direct reference in this release
`At1g62560`	Catalyzes the conversion of methylthioalkyl glucosinolates of any chain length into methylsulfinylalkyl glucosinolates.	No verified direct reference in this release
`At1g65860`	Catalyzes the conversion of methylthioalkyl glucosinolates into methylsulfinylalkyl glucosinolates.	No verified direct reference in this release
`At1g62620`	Catalyzes the conversion of methylthioalkyl glucosinolates of any chain length into methylsulfinylalkyl glucosinolates.	No verified direct reference in this release
`At1g63370`	Catalyzes the conversion of methylthioalkyl glucosinolates of any chain length into methylsulfinylalkyl glucosinolates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026864 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0019761 glucosinolate biosynthetic process Biological Process

GO:0033506 glucosinolate biosynthetic process from homomethionine Biological Process

GO:0046620 regulation of organ growth Biological Process

GO:0046885 regulation of hormone biosynthetic process Biological Process

GO:0048444 floral organ morphogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004497 monooxygenase activity Molecular Function

GO:0004499 N,N-dimethylaniline monooxygenase activity Molecular Function

GO:0050660 flavin adenine dinucleotide binding Molecular Function

GO:0050661 NADP binding Molecular Function

KEGG gene cross-reference

ath:AT1G12140

ath:AT1G62560

ath:AT1G62620

ath:AT1G63370

ath:AT1G65860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.746

Rank 1 · LXL04_026864 · OH-1004

Nucleus0.363

Rank 2 · LXL04_026864 · OH-1004

Mitochondrion0.054

Rank 3 · LXL04_026864 · OH-1004

Endoplasmic reticulum0.048

Rank 4 · LXL04_026864 · OH-1004

Peroxisome0.045

Rank 5 · LXL04_026864 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01946.24Thi441-79 aa

PF00743.26FMO-like42-268 aa

PF07992.21Pyr_redox_242-325 aa

PF01266.31DAO42-78 aa

PF03486.21HI0933_like42-206 aa

PF00890.31FAD_binding_243-80 aa

PF13454.13NAD_binding_944-200 aa

PF13450.13NAD_binding_845-79 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026864	`PF01946.24`	Thi4	41	79	9.4e-07	29.0
LXL04_026864	`PF00743.26`	FMO-like	42	268	1.4e-54	186.2
LXL04_026864	`PF07992.21`	Pyr_redox_2	42	325	6.6e-19	69.1
LXL04_026864	`PF01266.31`	DAO	42	78	7.9e-11	42.8
LXL04_026864	`PF03486.21`	HI0933_like	42	206	1.1e-07	32.4
LXL04_026864	`PF00890.31`	FAD_binding_2	43	80	2e-06	28.0
LXL04_026864	`PF13454.13`	NAD_binding_9	44	200	4e-08	34.1
LXL04_026864	`PF13450.13`	NAD_binding_8	45	79	6.5e-10	39.9
LXL04_026864	`PF01593.31`	Amino_oxidase	50	78	2e-09	38.0
LXL04_026864	`PF13738.13`	Pyr_redox_3	133	331	8e-17	62.2
LXL04_026864	`PF13434.13`	Lys_Orn_oxgnase	152	279	2.4e-08	34.2
LXL04_026864	`PF00743.26`	FMO-like	292	411	1.4e-54	186.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A8MRX0`	Arabidopsis thaliana	Flavin-containing monooxygenase FMO GS-OX5	52.020%	Swiss-Prot	strong database homology
`Q9SXE1`	Arabidopsis thaliana	Flavin-containing monooxygenase FMO GS-OX3	48.522%	Swiss-Prot	moderate database homology
`Q9SS04`	Arabidopsis thaliana	Flavin-containing monooxygenase FMO GS-OX1	49.364%	Swiss-Prot	moderate database homology
`Q9SXD5`	Arabidopsis thaliana	Flavin-containing monooxygenase FMO GS-OX-like 3	48.092%	Swiss-Prot	moderate database homology
`Q9C8U0`	Arabidopsis thaliana	Flavin-containing monooxygenase FMO GS-OX-like 5	47.837%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card