LXL04_026766 | RubberDandelionOmics

Gene overview

LXL04_026766

Reference: OH-1004 Chr: Chr06 Coordinates: 2661800-2664998 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3153 bp · LXL04_026766|LXL04_026766|OH1004|cDNA

ATGGCCGAAGCCTTAGTCAGAATTGCTGCTGAAGGGATACTAGAAAGAGTGTTATCTTTAGCTACTAGCGAAATCGTCCTTGCTTGGGGTTATGAAGAGAAGTTAGCCGACCTTCATAGAACCTTGGAGCTCATTAGTGCCAAATTGCGTGATTCTGAAAAACAAAAGGGTACGGAGGCTGTGATGGTGTGGTTGAAACAACTAAAACATGTTGTTGGTGAAGCTAATGATGTGTTGGATGAGATCCATTACGAGAAGTT...

CDS

Download CDS FASTA

3153 bp · LXL04_026766|LXL04_026766|OH1004|CDS

ATGGCCGAAGCCTTAGTCAGAATTGCTGCTGAAGGGATACTAGAAAGAGTGTTATCTTTAGCTACTAGCGAAATCGTCCTTGCTTGGGGTTATGAAGAGAAGTTAGCCGACCTTCATAGAACCTTGGAGCTCATTAGTGCCAAATTGCGTGATTCTGAAAAACAAAAGGGTACGGAGGCTGTGATGGTGTGGTTGAAACAACTAAAACATGTTGTTGGTGAAGCTAATGATGTGTTGGATGAGATCCATTACGAGAAGTT...

Protein

Download Protein FASTA

1050 aa · LXL04_026766|LXL04_026766|OH1004|PROTEIN

MAEALVRIAAEGILERVLSLATSEIVLAWGYEEKLADLHRTLELISAKLRDSEKQKGTEAVMVWLKQLKHVVGEANDVLDEIHYEKLRREVKKRDLMARKVSTLPSFKKLSFRLEMGHKIEDVSKKLFEINKQANDLGLQNEQPGVFPNSLFRETDPYLEEFKVVGRESDELHIVQLLTKSRKEEKLTIVPIVGMGGIGKTTLAKSIYNNSSIEQHFDVKVWLCVSVKVEVVEKLLAKIYESLAGEECKSEMRANLITSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026766`
TK1151 ID	TkA07G006490
OH-1004 ID	LXL04_026766
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.500
Protein coverage (%)	TK1151 98.387 / OH-1004 91.714 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026766

Location Chr06:2661800-2664998 (-)

Description Similar to RGA1: Putative disease resistance protein RGA1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14470`	Potential disease resistance protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026766 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0051607 defense response to virus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G14470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.646

Rank 1 · LXL04_026766 · OH-1004

Cytoplasm0.208

Rank 2 · LXL04_026766 · OH-1004

Nucleus0.168

Rank 3 · LXL04_026766 · OH-1004

Endoplasmic reticulum0.077

Rank 4 · LXL04_026766 · OH-1004

Plastid0.030

Rank 5 · LXL04_026766 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18052.7Rx_N13-96 aa

PF00931.29NB-ARC177-340 aa

PF23559.2WHD_DRP427-498 aa

PF23598.2LRR_14570-762 aa

PF25019.1LRR_R13L1-DRL21674-808 aa

PF23598.2LRR_14949-1028 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026766	`PF18052.7`	Rx_N	13	96	4.4e-15	56.3
LXL04_026766	`PF00931.29`	NB-ARC	177	340	3.8e-35	121.7
LXL04_026766	`PF23559.2`	WHD_DRP	427	498	2.6e-18	66.5
LXL04_026766	`PF23598.2`	LRR_14	570	762	7.7e-28	98.0
LXL04_026766	`PF25019.1`	LRR_R13L1-DRL21	674	808	2.4e-38	131.6
LXL04_026766	`PF23598.2`	LRR_14	949	1028	7.7e-28	98.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRR4`	Arabidopsis thaliana	Putative disease resistance RPP13-like protein 1	30.233%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card