Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2103 bp · LXL04_026479|LXL04_026479|OH1004|cDNA
ATGAGACATTGCATAAGGATCGCCATCAGCTTTCTATTTGTCTCTTATCATGTCGCCAATGGCAGCGTCCAACTCCTTTCCAAATCGAAGCTTCAAAAATGCGAAAAGGTTTCAAATGATGCTCCTCTTAACTGCACCAAAAAAGTCATCGTCAATATGGCTGTTCCTAGTGAATCAAGCGGCAGAGAAGCATCGCTTGTGGCCGAAATAGTGGAGGTTGAGGAAAATGCGACTGATAATAACATGAGAACGGTTCGAGA...
2103 bp · LXL04_026479|LXL04_026479|OH1004|CDS
ATGAGACATTGCATAAGGATCGCCATCAGCTTTCTATTTGTCTCTTATCATGTCGCCAATGGCAGCGTCCAACTCCTTTCCAAATCGAAGCTTCAAAAATGCGAAAAGGTTTCAAATGATGCTCCTCTTAACTGCACCAAAAAAGTCATCGTCAATATGGCTGTTCCTAGTGAATCAAGCGGCAGAGAAGCATCGCTTGTGGCCGAAATAGTGGAGGTTGAGGAAAATGCGACTGATAATAACATGAGAACGGTTCGAGA...
Protein
Download Protein FASTA700 aa · LXL04_026479|LXL04_026479|OH1004|PROTEIN
MRHCIRIAISFLFVSYHVANGSVQLLSKSKLQKCEKVSNDAPLNCTKKVIVNMAVPSESSGREASLVAEIVEVEENATDNNMRTVRDPPVITVNKSAAYAQYHLTYIRDVPYKPEELYFKTRKCDRNAGPNIVHDCVALRDEHGNIIERTKPFCCSCGGQRRVPSSCGNFFDKMVKGKVNTAHCLRFPGEWFHVFGIGQHSVGFTIRVEVKTGSKISEVIISPQNRTAISHDNFLRVNLIGDYVGYNDIPSFENFFLVTP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_026479 |
|---|---|
| TK1151 ID | TkA03G220440 |
| OH-1004 ID | LXL04_026479 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 97.900 |
| Protein coverage (%) | TK1151 57.485 / OH-1004 13.714Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_026479 | ||||||
|---|---|---|---|---|---|---|---|
| Location | Chr05:126942706-126946897 (+) | ||||||
| Description | Similar to HAP2: Protein HAPLESS 2 | ||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisRice
| ||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||
| GO annotations (OH1004 source) | GO:0007338 single fertilization Biological Process GO:0007342 fusion of sperm to egg plasma membrane involved in single fertilization Biological Process GO:0009566 fertilization Biological Process GO:0009567 double fertilization forming a zygote and endosperm Biological Process GO:0010183 pollen tube guidance Biological Process GO:0045026 plasma membrane fusion Biological Process GO:0048235 pollen sperm cell differentiation Biological Process GO:0051205 protein insertion into membrane Biological Process GO:0061936 fusion of sperm to egg plasma membrane involved in double fertilization forming a zygote and endosperm Biological Process GO:0005576 extracellular region Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component | ||||||
| KEGG gene cross-reference | ath:AT4G11720 dosa:Os09g0525700 nve:5507857 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF10699.15HAP2-GCS143-555 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_026479 | PF10699.15 | HAP2-GCS1 | 43 | 555 | 9e-143 | 477.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.