LXL04_026412 | RubberDandelionOmics

Gene overview

LXL04_026412

Reference: OH-1004 Chr: Chr05 Coordinates: 125949796-125954515 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2805 bp · LXL04_026412|LXL04_026412|OH1004|cDNA

ATGAAGAAGATGGATTTAAAGGGAGTTGTTGGACTTGTGTTCGGAAACGAGAATTCAAGTTCCAATGAAGATAGGTTGGTTCCGATTCATAATTTTCATTTGATATTTAGTACATGTTATGTTGAACGCCTGCTTGATTGCATAAGTAATGGTCAGCTGGCTGATGATAGAAGAAATGCAATGGCAGAGCTTCAATCTGTTGTTGCAGAAAGTCATGCTGCCCAATTGGCTTTTGGAGAAATGGGCTTTCCTGTACTATT...

CDS

Download CDS FASTA

2805 bp · LXL04_026412|LXL04_026412|OH1004|CDS

ATGAAGAAGATGGATTTAAAGGGAGTTGTTGGACTTGTGTTCGGAAACGAGAATTCAAGTTCCAATGAAGATAGGTTGGTTCCGATTCATAATTTTCATTTGATATTTAGTACATGTTATGTTGAACGCCTGCTTGATTGCATAAGTAATGGTCAGCTGGCTGATGATAGAAGAAATGCAATGGCAGAGCTTCAATCTGTTGTTGCAGAAAGTCATGCTGCCCAATTGGCTTTTGGAGAAATGGGCTTTCCTGTACTATT...

Protein

Download Protein FASTA

934 aa · LXL04_026412|LXL04_026412|OH1004|PROTEIN

MKKMDLKGVVGLVFGNENSSSNEDRLVPIHNFHLIFSTCYVERLLDCISNGQLADDRRNAMAELQSVVAESHAAQLAFGEMGFPVLLGVLRDRDDVEMVRGALETLVSALTPIAHAKVHANEVQPALMNTDLLSRDGNSISLLLSLLGEDDFYIRYYTLQLLTALLTNSPIRLQEVILTIPRGITRLMDMLMDREVIRNEALLLLTYLTREAEEIQKILVFEGAFEKIFSIIKEEGGSEGGVVVQDCLELLNNLLRNNAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026412`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026412

Location Chr05:125949796-125954515 (-)

Description Similar to GC6: Golgin candidate 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g27530`	Golgi matrix protein playing a role in tethering of vesicles to Golgi membranes and in maintaining the overall structure of the Golgi apparatus.	MAG4/Atp115 is a golgi-localized tethering factor that mediates efficient anterograde transport in Arabidopsis.2010 · DOI: 10.1093/pcp/pcq137

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026412 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0007030 Golgi organization Biological Process

GO:0007264 small GTPase-mediated signal transduction Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0032252 secretory granule localization Biological Process

GO:0032527 protein exit from endoplasmic reticulum Biological Process

GO:0045056 transcytosis Biological Process

GO:0048211 Golgi vesicle docking Biological Process

GO:0048219 inter-Golgi cisterna vesicle-mediated transport Biological Process

GO:0048280 vesicle fusion with Golgi apparatus Biological Process

KEGG gene cross-reference

ath:AT3G27530

bta:317724

hsa:8615

mmu:56041

rno:56042

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.460

Rank 1 · LXL04_026412 · OH-1004

Golgi apparatus0.274

Rank 2 · LXL04_026412 · OH-1004

Nucleus0.246

Rank 3 · LXL04_026412 · OH-1004

Lysosome / Vacuole0.163

Rank 4 · LXL04_026412 · OH-1004

Endoplasmic reticulum0.090

Rank 5 · LXL04_026412 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25598.2ARM_PUB44-230 aa

PF04869.21Uso1_p115_head384-703 aa

PF04871.19Uso1_p115_C810-927 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026412	`PF25598.2`	ARM_PUB	44	230	5.8e-07	29.9
LXL04_026412	`PF04869.21`	Uso1_p115_head	384	703	6.3e-28	98.5
LXL04_026412	`PF04871.19`	Uso1_p115_C	810	927	3.4e-22	79.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B0F9L4`	Arabidopsis thaliana	Golgin candidate 6	64.509%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card