LXL04_026373 | RubberDandelionOmics

Gene overview

LXL04_026373

Reference: OH-1004 Chr: Chr05 Coordinates: 125358678-125359583 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

906 bp · LXL04_026373|LXL04_026373|OH1004|cDNA

ATGGAACAAGATCGTAAATCAGAGCCATGCCCATCTGAAGCTTCAAGTATATCGGCAGAAGGAGATTGCTTGAAGCACAAGAAATTGGATAGCAAAGTCATCACAGAGGGTTCTTCCGATATTCAACTCAACAGGAGGATTGTTAATCAATCATCTTCTCGGCCGCCTTTTCTTGATCTCAAACTGTCAACTACAGAAGACAAGAAAACAGAGCTCAATCTCTTTAACCCTTCAAGGGCGGTGGAAGGCGTCGCAACTTC...

CDS

Download CDS FASTA

906 bp · LXL04_026373|LXL04_026373|OH1004|CDS

ATGGAACAAGATCGTAAATCAGAGCCATGCCCATCTGAAGCTTCAAGTATATCGGCAGAAGGAGATTGCTTGAAGCACAAGAAATTGGATAGCAAAGTCATCACAGAGGGTTCTTCCGATATTCAACTCAACAGGAGGATTGTTAATCAATCATCTTCTCGGCCGCCTTTTCTTGATCTCAAACTGTCAACTACAGAAGACAAGAAAACAGAGCTCAATCTCTTTAACCCTTCAAGGGCGGTGGAAGGCGTCGCAACTTC...

Protein

Download Protein FASTA

301 aa · LXL04_026373|LXL04_026373|OH1004|PROTEIN

MEQDRKSEPCPSEASSISAEGDCLKHKKLDSKVITEGSSDIQLNRRIVNQSSSRPPFLDLKLSTTEDKKTELNLFNPSRAVEGVATSSQASESPDDDNREKSRVFSCNYCKREFSTSQALGGHQNAHKQERQIAKRRQMEVPPYGHLVPPPPHHYGNFTYYPSFANLTNAPISTNRSSWSTSPLNYRFNGVGHHEQFTNRLQYFDRTKMLESFHGNGATNTSVGFGSSVMATASPSSRYDQGCSTHDFFGGISGNGSQTA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026373`
TK1151 ID	TkAUNG022900
OH-1004 ID	LXL04_026373
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	90.500
Protein coverage (%)	TK1151 87.500 / OH-1004 48.837 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026373

Location Chr05:125358678-125359583 (+)

Description Similar to ZFP6: Zinc finger protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67030`	Probable transcription factor required for the initiation of inflorescence trichomes in response to gibberellin and cytokinin.	Zinc Finger Protein 6 (ZFP6) regulates trichome initiation by integrating gibberellin and cytokinin signaling in Arabidopsis thaliana.2013 · DOI: 10.1111/nph.12211 The Arabidopsis ZINC FINGER PROTEIN3 Interferes with Abscisic Acid and Light Signaling in Seed Germination and Plant Development.2014 · DOI: 10.1104/pp.113.234294
`At1g24625`	Acts as a negative regulator of abscisic acid (ABA) signaling during germination and early seedling development.	The Arabidopsis ZINC FINGER PROTEIN3 Interferes with Abscisic Acid and Light Signaling in Seed Germination and Plant Development.2014 · DOI: 10.1104/pp.113.234294
`At1g80730`	May play a role in the regulation of shoot development, downstream of photomorphogenic activation (Probable).	The Arabidopsis ZINC FINGER PROTEIN3 Interferes with Abscisic Acid and Light Signaling in Seed Germination and Plant Development.2014 · DOI: 10.1104/pp.113.234294 Expression analysis of an Arabidopsis C2H2 zinc finger protein gene.1996 · DOI: 10.1007/bf00020477
`At1g66140`	Acts as a negative regulator of abscisic acid (ABA) signaling during germination and early seedling development.	The Arabidopsis ZINC FINGER PROTEIN3 Interferes with Abscisic Acid and Light Signaling in Seed Germination and Plant Development.2014 · DOI: 10.1104/pp.113.234294
`At5g57520`	Transcription factor involved in the regulation of floral organ abscission and required for seed and silique development.	Stamen abscission zone transcriptome profiling reveals new candidates for abscission control: enhanced retention of floral organs in transgenic plants overexpressing Arabidopsis ZINC FINGER PROTEIN2.2008 · DOI: 10.1104/pp.107.110908 ZINC FINGER PROTEIN2 suppresses funiculus lignification to ensure seed loading efficiency in Arabidopsis.2025 · DOI: 10.1016/j.devcel.2025.01.021

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026373 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010026 trichome differentiation Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0019760 glucosinolate metabolic process Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0060860 regulation of floral organ abscission Biological Process

KEGG gene cross-reference

ath:AT1G24625

ath:AT1G66140

ath:AT1G67030

ath:AT1G80730

ath:AT5G57520

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.976

Rank 1 · LXL04_026373 · OH-1004

Cytoplasm0.089

Rank 2 · LXL04_026373 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_026373 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_026373 · OH-1004

Plastid0.009

Rank 5 · LXL04_026373 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13912.13zf-C2H2_6104-130 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026373	`PF13912.13`	zf-C2H2_6	104	130	1.1e-06	29.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39265`	Arabidopsis thaliana	Zinc finger protein 6	53.333%	Swiss-Prot	weak database homology
`Q39266`	Arabidopsis thaliana	Zinc finger protein 7	55.172%	Swiss-Prot	weak database homology
`Q42485`	Arabidopsis thaliana	Zinc finger protein 1	77.778%	Swiss-Prot	weak database homology
`Q39263`	Arabidopsis thaliana	Zinc finger protein 4	79.412%	Swiss-Prot	weak database homology
`Q39261`	Arabidopsis thaliana	Zinc finger protein 2	72.973%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card