LXL04_025656 | RubberDandelionOmics

Gene overview

LXL04_025656

Reference: OH-1004 Chr: Chr05 Coordinates: 114807326-114822187 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5670 bp · LXL04_025656|LXL04_025656|OH1004|cDNA

ATGAAGAAAAAAGAACAGTTGACACCTGTCACTGTCACTGGCAAGTCCACATCATCAGATGGAACATCTGTTCCATCTGTGTCTGTCACTGTGATGTCAATGTCATCAGAGAGTAGCTGGAAGCCTACAACTTGTGTCAAGACTTCTTGCAAGGAACTACCTTGTAAACTTGAAGCAATGTCATCAATGGTATTAAGAGCTTCCTTGCTTTTTCTTCTGATCTTTAGAGAATCAGATGATCTGTCAATGAAGAGGACCAT...

CDS

Download CDS FASTA

5670 bp · LXL04_025656|LXL04_025656|OH1004|CDS

ATGAAGAAAAAAGAACAGTTGACACCTGTCACTGTCACTGGCAAGTCCACATCATCAGATGGAACATCTGTTCCATCTGTGTCTGTCACTGTGATGTCAATGTCATCAGAGAGTAGCTGGAAGCCTACAACTTGTGTCAAGACTTCTTGCAAGGAACTACCTTGTAAACTTGAAGCAATGTCATCAATGGTATTAAGAGCTTCCTTGCTTTTTCTTCTGATCTTTAGAGAATCAGATGATCTGTCAATGAAGAGGACCAT...

Protein

Download Protein FASTA

1889 aa · LXL04_025656|LXL04_025656|OH1004|PROTEIN

MKKKEQLTPVTVTGKSTSSDGTSVPSVSVTVMSMSSESSWKPTTCVKTSCKELPCKLEAMSSMVLRASLLFLLIFRESDDLSMKRTIDGLSEGKPGSRSYSSPFSCIFNINQEISTRLITETGKVKLASITELETTIHLILYPIWFTTLPIFDYLREAITWHSNNEEDMRIQTDLRREIVFRENLPLNRLFSIADKEKQKYNLFFKRPRQKKPPSNKCLLTTVFRLPLLFLNSSTQILQSTTFPIFFNRRRIPPVGSQKP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025656`
TK1151 ID	TkA06G047280
OH-1004 ID	LXL04_025656
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	84.100
Protein coverage (%)	TK1151 98.082 / OH-1004 88.989 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025656

Location Chr05:114807326-114822187 (-)

Description Similar to M3KE1: MAP3K epsilon protein kinase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g13530`	Serine/threonine-protein kinase involved in the spatial and temporal control system organizing cortical activities in mitotic and postmitotic cells.	No verified direct reference in this release
`At3g07980`	Serine/threonine-protein kinase involved in the spatial and temporal control system organizing cortical activities in mitotic and postmitotic cells.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025656 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000165 MAPK cascade Biological Process

GO:0045995 regulation of embryonic development Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0051301 cell division Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0051510 regulation of unidimensional cell growth Biological Process

GO:0061387 regulation of extent of cell growth Biological Process

GO:0005730 nucleolus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005815 microtubule organizing center Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT3G07980

ath:AT3G13530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.551

Rank 1 · LXL04_025656 · OH-1004

Nucleus0.275

Rank 2 · LXL04_025656 · OH-1004

Cell membrane0.159

Rank 3 · LXL04_025656 · OH-1004

Golgi apparatus0.094

Rank 4 · LXL04_025656 · OH-1004

Mitochondrion0.080

Rank 5 · LXL04_025656 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase294-541 aa

PF07714.24PK_Tyr_Ser-Thr296-537 aa

PF07714.24PK_Tyr_Ser-Thr550-790 aa

PF00069.32Pkinase551-794 aa

PF24768.2ARM_ARMC51587-1733 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025656	`PF00069.32`	Pkinase	294	541	9.1e-132	439.0
LXL04_025656	`PF07714.24`	PK_Tyr_Ser-Thr	296	537	7.4e-89	298.2
LXL04_025656	`PF07714.24`	PK_Tyr_Ser-Thr	550	790	7.4e-89	298.2
LXL04_025656	`PF00069.32`	Pkinase	551	794	9.1e-132	439.0
LXL04_025656	`PF24768.2`	ARM_ARMC5	1587	1733	9.5e-09	35.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LJD8`	Arabidopsis thaliana	MAP3K epsilon protein kinase 1	69.397%	Swiss-Prot	strong database homology
`Q9SFB6`	Arabidopsis thaliana	MAP3K epsilon protein kinase 2	65.540%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card