LXL04_025616 | RubberDandelionOmics

Gene overview

LXL04_025616

Reference: OH-1004 Chr: Chr05 Coordinates: 114350962-114352764 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1182 bp · LXL04_025616|LXL04_025616|OH1004|cDNA

ATGGCCGAAGTGATTTCGCCAATGGACATCGACGACAGTAATCCGTCTCAAGGACCTAACGGGAACAAGGGCAAAGCTGTAGCCTCTTCCGGCGGCGCTCCACCAGCGCACACCAAAGCCACTCCATGGGTCGAGAAGTTCCGGCCTCAATCTCTAGCCGACGTCGCCGCTCATCGTGACATAATCGATACCATTGATAGGCTTACAAGTGAGAACAAAATGCCTCATCTGTTACTGTATGGACCACCGGGCACCGGAAA...

CDS

Download CDS FASTA

1182 bp · LXL04_025616|LXL04_025616|OH1004|CDS

ATGGCCGAAGTGATTTCGCCAATGGACATCGACGACAGTAATCCGTCTCAAGGACCTAACGGGAACAAGGGCAAAGCTGTAGCCTCTTCCGGCGGCGCTCCACCAGCGCACACCAAAGCCACTCCATGGGTCGAGAAGTTCCGGCCTCAATCTCTAGCCGACGTCGCCGCTCATCGTGACATAATCGATACCATTGATAGGCTTACAAGTGAGAACAAAATGCCTCATCTGTTACTGTATGGACCACCGGGCACCGGAAA...

Protein

Download Protein FASTA

393 aa · LXL04_025616|LXL04_025616|OH1004|PROTEIN

MAEVISPMDIDDSNPSQGPNGNKGKAVASSGGAPPAHTKATPWVEKFRPQSLADVAAHRDIIDTIDRLTSENKMPHLLLYGPPGTGKTSTILAVARKLFGSQMHNMVLELNASDERGIDVVRQQIQDFASTQSFSFGYLFVSVHTFAKFISSFNHQQLVDLGMFVSAKSMVKLVLLDEADAMTKDAQFALRRVIERYTKNTRFALICNNVNKIIPALQSRCTRFRFAPLEPVHVTERLKHVITSEGLDVTEDGLAALVRL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025616`
TK1151 ID	TkA06G048700
OH-1004 ID	LXL04_025616
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025616

Location Chr05:114350962-114352764 (-)

Description Similar to RFC3: Replication factor C subunit 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77470`	Functions in cell replication and proliferation.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0775200`	May be involved in DNA replication and thus regulate cell proliferation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025616 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000076 DNA replication checkpoint signaling Biological Process

GO:0006260 DNA replication Biological Process

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006272 leading strand elongation Biological Process

GO:0006281 DNA repair Biological Process

GO:0006952 defense response Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:1900264 positive regulation of DNA-directed DNA polymerase activity Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005663 DNA replication factor C complex Cellular Component

GO:0031389 Rad17 RFC-like complex Cellular Component

KEGG gene cross-reference

ath:AT1G77470

ddi:DDB_G0282235

dosa:Os02g0775200

hsa:5985

mmu:72151

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.750

Rank 1 · LXL04_025616 · OH-1004

Cytoplasm0.232

Rank 2 · LXL04_025616 · OH-1004

Mitochondrion0.096

Rank 3 · LXL04_025616 · OH-1004

Peroxisome0.029

Rank 4 · LXL04_025616 · OH-1004

Cell membrane0.019

Rank 5 · LXL04_025616 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03215.22Rad1739-205 aa

PF13177.13DNA_pol3_delta259-229 aa

PF13401.13AAA_2276-205 aa

PF00004.36AAA77-228 aa

PF25361.2AAA_lid_RFC1234-284 aa

PF21960.3RCF1-5-like_lid237-276 aa

PF08542.17Rep_fac_C294-379 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025616	`PF03215.22`	Rad17	39	205	6.8e-12	46.4
LXL04_025616	`PF13177.13`	DNA_pol3_delta2	59	229	3.5e-12	47.3
LXL04_025616	`PF13401.13`	AAA_22	76	205	5.4e-06	27.5
LXL04_025616	`PF00004.36`	AAA	77	228	5.5e-15	56.7
LXL04_025616	`PF25361.2`	AAA_lid_RFC1	234	284	1.4e-06	28.3
LXL04_025616	`PF21960.3`	RCF1-5-like_lid	237	276	2e-06	28.3
LXL04_025616	`PF08542.17`	Rep_fac_C	294	379	1.4e-20	74.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAQ8`	Arabidopsis thaliana	Replication factor C subunit 5	70.324%	Swiss-Prot	strong database homology
`Q6YZ54`	Oryza sativa subsp. japonica	Replication factor C subunit 3	71.355%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card