LXL04_025276 | RubberDandelionOmics

Gene overview

LXL04_025276

Reference: OH-1004 Chr: Chr05 Coordinates: 109046390-109048849 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2184 bp · LXL04_025276|LXL04_025276|OH1004|cDNA

ATGAGTGGAGTTGTGCTGGTGGCTGTTGCTGCCGCCGTCGGTAACTTAATTCAAGGATGGGATAACGCCACTATTGCCGGGGCTGTTTTATACATGAAGAAAGAGTTCAATCTGCAAAATGAACCAACAATCGAGGGTCTAATCGTGGCTATGTCGTTAATTGGTGCTACTCTAGTCACGACTTGCTCTGGTGCGGTATCCGACTGCGTGGGCCGACGTCCGATGCTCGTTATCTCCTCCATTTTTTACATCTCTGGCGG...

CDS

Download CDS FASTA

2184 bp · LXL04_025276|LXL04_025276|OH1004|CDS

ATGAGTGGAGTTGTGCTGGTGGCTGTTGCTGCCGCCGTCGGTAACTTAATTCAAGGATGGGATAACGCCACTATTGCCGGGGCTGTTTTATACATGAAGAAAGAGTTCAATCTGCAAAATGAACCAACAATCGAGGGTCTAATCGTGGCTATGTCGTTAATTGGTGCTACTCTAGTCACGACTTGCTCTGGTGCGGTATCCGACTGCGTGGGCCGACGTCCGATGCTCGTTATCTCCTCCATTTTTTACATCTCTGGCGG...

Protein

Download Protein FASTA

727 aa · LXL04_025276|LXL04_025276|OH1004|PROTEIN

MSGVVLVAVAAAVGNLIQGWDNATIAGAVLYMKKEFNLQNEPTIEGLIVAMSLIGATLVTTCSGAVSDCVGRRPMLVISSIFYISGGLVMLWSPNVYILLLGRLLDGFGIGLAVTLVPVYISETSPPEIRGSLNTLPQFMGSGGMFLSYCMVFGMSLMESPNWRVMLGVLSIPSLLYFFFAIFFLPESPRWLVSKGRMLEAKQVLQRLRGREDVAGELALLVEGLEVGGDATIEEYTIGPVNGIEHDQTITEADKIRLYG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025276`
TK1151 ID	TkA06G070400
OH-1004 ID	LXL04_025276
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 72.902 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025276

Location Chr05:109046390-109048849 (+)

Description Similar to MSSP2: Monosaccharide-sensing protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35300`	Sugar proton-coupled antiporter which contributes to vacuolar sugar import (e.g. monosaccharides including glucose, sucrose and fructose), particularly during stress responses (e.g. in response to cold).	Molecular identification and physiological characterization of a novel monosaccharide transporter from Arabidopsis involved in vacuolar sugar transport.2006 · DOI: 10.1105/tpc.106.047290 Proton-driven sucrose symport and antiport are provided by the vacuolar transporters SUC4 and TMT1/2.2011 · DOI: 10.1111/j.1365-313x.2011.04672.x
`At3g51490`	Sugar proton-coupled antiporter which contributes to vacuolar sugar import (e.g. monosaccharides including glucose,sucrose and fructose), particularly during stress responses (e.g. in response to cold).	Molecular identification and physiological characterization of a novel monosaccharide transporter from Arabidopsis involved in vacuolar sugar transport.2006 · DOI: 10.1105/tpc.106.047290
`At1g20840`	Sugar proton-coupled antiporter which contributes to vacuolar sugar import (e.g. monosaccharides including glucose, sucrose and fructose), particularly during stress responses (e.g. in response to cold).	Molecular identification and physiological characterization of a novel monosaccharide transporter from Arabidopsis involved in vacuolar sugar transport.2006 · DOI: 10.1105/tpc.106.047290 Increased activity of the vacuolar monosaccharide transporter TMT1 alters cellular sugar partitioning, sugar signaling, and seed yield in Arabidopsis.2010 · DOI: 10.1104/pp.110.162040 Proton-driven sucrose symport and antiport are provided by the vacuolar transporters SUC4 and TMT1/2.2011 · DOI: 10.1111/j.1365-313x.2011.04672.x
`At2g35740`	Plasma membrane inositol-proton symporter.	Arabidopsis INOSITOL TRANSPORTER2 mediates H+ symport of different inositol epimers and derivatives across the plasma membrane.2007 · DOI: 10.1104/pp.107.109033

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025276 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009624 response to nematode Biological Process

GO:0009744 response to sucrose Biological Process

GO:0009749 response to glucose Biological Process

GO:0009750 response to fructose Biological Process

GO:0015798 myo-inositol transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:1902074 response to salt Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G20840

ath:AT2G35740

ath:AT3G51490

ath:AT4G35300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.428

Rank 1 · LXL04_025276 · OH-1004

Cytoplasm0.217

Rank 2 · LXL04_025276 · OH-1004

Golgi apparatus0.186

Rank 3 · LXL04_025276 · OH-1004

Cell membrane0.179

Rank 4 · LXL04_025276 · OH-1004

Endoplasmic reticulum0.117

Rank 5 · LXL04_025276 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083.31Sugar_tr7-227 aa

PF07690.22MFS_112-195 aa

PF07690.22MFS_1496-660 aa

PF00083.31Sugar_tr499-720 aa

PF07690.22MFS_1546-709 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025276	`PF00083.31`	Sugar_tr	7	227	7.3e-93	312.6
LXL04_025276	`PF07690.22`	MFS_1	12	195	1.6e-27	97.1
LXL04_025276	`PF07690.22`	MFS_1	496	660	1.6e-27	97.1
LXL04_025276	`PF00083.31`	Sugar_tr	499	720	7.3e-93	312.6
LXL04_025276	`PF07690.22`	MFS_1	546	709	1.6e-27	97.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPQ8`	Arabidopsis thaliana	Monosaccharide-sensing protein 2	68.614%	Swiss-Prot	strong database homology
`Q9SD00`	Arabidopsis thaliana	Monosaccharide-sensing protein 3	60.453%	Swiss-Prot	strong database homology
`Q96290`	Arabidopsis thaliana	Monosaccharide-sensing protein 1	58.847%	Swiss-Prot	strong database homology
`Q9ZQP6`	Arabidopsis thaliana	Probable inositol transporter 3	36.328%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card