LXL04_024451 | RubberDandelionOmics

Gene overview

LXL04_024451

Reference: OH-1004 Chr: Chr05 Coordinates: 91036003-91037271 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

948 bp · LXL04_024451|LXL04_024451|OH1004|cDNA

ATGTCGTCACCGCGTTTAGGCATTCAGGGAGCCATTAACATACCAGGGAACACCTCTTTCCCCGGTTCCACATCCTCCATGGAATCAAATTTTCAGAAAACCCCAAACTTGACGGAAAGAAATTACCTCGGGTTCTCCGATTGTTCTTCCGTCGACAGCAGCTCAAACGTCTCCACCATATCAGAAGTCAACAAAAACAGTCTAAACCTCAAAGCTACTGAGTTACGACTCGGCCTTCCAGGATCTCAATCACCCGAACG...

CDS

Download CDS FASTA

948 bp · LXL04_024451|LXL04_024451|OH1004|CDS

ATGTCGTCACCGCGTTTAGGCATTCAGGGAGCCATTAACATACCAGGGAACACCTCTTTCCCCGGTTCCACATCCTCCATGGAATCAAATTTTCAGAAAACCCCAAACTTGACGGAAAGAAATTACCTCGGGTTCTCCGATTGTTCTTCCGTCGACAGCAGCTCAAACGTCTCCACCATATCAGAAGTCAACAAAAACAGTCTAAACCTCAAAGCTACTGAGTTACGACTCGGCCTTCCAGGATCTCAATCACCCGAACG...

Protein

Download Protein FASTA

315 aa · LXL04_024451|LXL04_024451|OH1004|PROTEIN

MSSPRLGIQGAINIPGNTSFPGSTSSMESNFQKTPNLTERNYLGFSDCSSVDSSSNVSTISEVNKNSLNLKATELRLGLPGSQSPERDQQNTLTSSEQLDEKPLFPLLPSQKIVVSGHKRVFTDTMDSCSETNGVISSQEPSTIKASVPINKVNSNPPVSKAQLVGWPPVRSSRKNILASSKNNEEVDGKPGPGALFVKVSMDGAPYLRKVDLRGYSTYQQLSSALEKMFSCFTIGQCGSQGGPGRGSLSESKLRDLLHG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024451`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024451

Location Chr05:91036003-91037271 (-)

Description Similar to IAA8: Auxin-responsive protein IAA8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g22670`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`At5g65670`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`At4g29080`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release
`At4g14550`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0601300`	Aux/IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024451 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0010311 lateral root formation Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:1901332 negative regulation of lateral root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT2G22670

ath:AT4G14550

ath:AT4G29080

ath:AT5G65670

dosa:Os12g0601300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.864

Rank 1 · LXL04_024451 · OH-1004

Cytoplasm0.197

Rank 2 · LXL04_024451 · OH-1004

Cell membrane0.067

Rank 3 · LXL04_024451 · OH-1004

Endoplasmic reticulum0.029

Rank 4 · LXL04_024451 · OH-1004

Plastid0.015

Rank 5 · LXL04_024451 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02309.23AUX_IAA72-306 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024451	`PF02309.23`	AUX_IAA	72	306	2.5e-85	286.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38826`	Arabidopsis thaliana	Auxin-responsive protein IAA8	60.714%	Swiss-Prot	strong database homology
`Q38827`	Arabidopsis thaliana	Auxin-responsive protein IAA9	59.416%	Swiss-Prot	strong database homology
`Q9ZSY8`	Arabidopsis thaliana	Auxin-responsive protein IAA27	51.447%	Swiss-Prot	strong database homology
`Q38832`	Arabidopsis thaliana	Auxin-responsive protein IAA14	50.593%	Swiss-Prot	strong database homology
`P0C132`	Oryza sativa subsp. japonica	Auxin-responsive protein IAA30	64.881%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card