LXL04_024148 | RubberDandelionOmics

Gene overview

LXL04_024148

Reference: OH-1004 Chr: Chr05 Coordinates: 82396355-82408057 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5451 bp · LXL04_024148|LXL04_024148|OH1004|cDNA

ATGTCGAATTCGCGTGCCGGAGGTGGAGGAGGGATACCTAGAGGTATTGGCCTGGCCAACACTGTTCATTCTGAAGTCGCTCCGTGCTTGCCGTTGCCGTCGCTGCCGGTCTTCTGCGGCGCCCTTGACCAGGACCTGCGGTTAGTTGACGAGCCTACGGGCTCGGCCAGACAGTCCAACCGCAGTGATGTTGCCGATCAGGCTAGCAAGATATCTAAACTTCTCCAGGCTACTGATGTGTCTTACCTGAATCTTAGATC...

CDS

Download CDS FASTA

5451 bp · LXL04_024148|LXL04_024148|OH1004|CDS

ATGTCGAATTCGCGTGCCGGAGGTGGAGGAGGGATACCTAGAGGTATTGGCCTGGCCAACACTGTTCATTCTGAAGTCGCTCCGTGCTTGCCGTTGCCGTCGCTGCCGGTCTTCTGCGGCGCCCTTGACCAGGACCTGCGGTTAGTTGACGAGCCTACGGGCTCGGCCAGACAGTCCAACCGCAGTGATGTTGCCGATCAGGCTAGCAAGATATCTAAACTTCTCCAGGCTACTGATGTGTCTTACCTGAATCTTAGATC...

Protein

Download Protein FASTA

1816 aa · LXL04_024148|LXL04_024148|OH1004|PROTEIN

MSNSRAGGGGGIPRGIGLANTVHSEVAPCLPLPSLPVFCGALDQDLRLVDEPTGSARQSNRSDVADQASKISKLLQATDVSYLNLRSEVTKSPYGREEHLDLYDEVLRCNSEAFEHVAPGSTKEQMYNNSVPNNKVPERKLFVKNLSTNNEPVKDKGETQRQHEHDAVTSSSRKPKSKKKTSDDTLPTEPDGSELQDAAVERFCEVLEDLCGKAEISADDREEGESEWLLLPVGNLRTLVKEVMAARTSKILHFVPVALL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024148`
TK1151 ID	TkA06G172590
OH-1004 ID	LXL04_024148
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024148

Location Chr05:82396355-82408057 (-)

Description Similar to SCC2: Sister chromatid cohesion protein SCC2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g15540`	Essential protein required for cell fate determination during embryogenesis.	The plant adherin AtSCC2 is required for embryogenesis and sister-chromatid cohesion during meiosis in Arabidopsis.2009 · DOI: 10.1111/j.1365-313x.2009.03845.x Cohesin gene defects may impair sister chromatid alignment and genome stability in Arabidopsis thaliana.2009 · DOI: 10.1007/s00412-009-0220-x The Arabidopsis homolog of Scc4/MAU2 is essential for embryogenesis.2017 · DOI: 10.1242/jcs.196865

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024148 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000070 mitotic sister chromatid segregation Biological Process

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0007062 sister chromatid cohesion Biological Process

GO:0007064 mitotic sister chromatid cohesion Biological Process

GO:0008104 intracellular protein localization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010468 regulation of gene expression Biological Process

KEGG gene cross-reference

ath:AT5G15540

dre:794108

hsa:25836

mmu:71175

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.916

Rank 1 · LXL04_024148 · OH-1004

Cytoplasm0.145

Rank 2 · LXL04_024148 · OH-1004

Cell membrane0.029

Rank 3 · LXL04_024148 · OH-1004

Golgi apparatus0.018

Rank 4 · LXL04_024148 · OH-1004

Endoplasmic reticulum0.016

Rank 5 · LXL04_024148 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00628.36PHD675-719 aa

PF20168.5PDS5844-1002 aa

PF12765.14Cohesin_HEAT870-911 aa

PF12830.14Nipped-B_C1369-1563 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024148	`PF00628.36`	PHD	675	719	5.7e-06	27.0
LXL04_024148	`PF20168.5`	PDS5	844	1002	4.7e-08	32.0
LXL04_024148	`PF12765.14`	Cohesin_HEAT	870	911	2.2e-13	51.0
LXL04_024148	`PF12830.14`	Nipped-B_C	1369	1563	4.7e-52	177.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A5HEI1`	Arabidopsis thaliana	Sister chromatid cohesion protein SCC2	57.796%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card