LXL04_023702 | RubberDandelionOmics

Gene overview

LXL04_023702

Reference: OH-1004 Chr: Chr05 Coordinates: 63985408-63988440 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2082 bp · LXL04_023702|LXL04_023702|OH1004|cDNA

ATGTCCATCTTGCCCTCTCAAAATCTTGGTTCATCGTCTTCGACATCTAATCTTTACGCTCAAAACCCTAATCCCAATCATGGATCCAATCTACCACAACCCGACTCTCCTTCGCACCCGACTCACGCCCTTCAATCTCTTCGAATCACCGCTCCTGTTGACATGCCTGATAGACTCACAGCAGAATCGACTGCTCCAACACCGGAAACTTCTGGTGGAATTTCCAAAAAGGTGAAAGAAGACCATAAACTAAATGGCAA...

CDS

Download CDS FASTA

2082 bp · LXL04_023702|LXL04_023702|OH1004|CDS

ATGTCCATCTTGCCCTCTCAAAATCTTGGTTCATCGTCTTCGACATCTAATCTTTACGCTCAAAACCCTAATCCCAATCATGGATCCAATCTACCACAACCCGACTCTCCTTCGCACCCGACTCACGCCCTTCAATCTCTTCGAATCACCGCTCCTGTTGACATGCCTGATAGACTCACAGCAGAATCGACTGCTCCAACACCGGAAACTTCTGGTGGAATTTCCAAAAAGGTGAAAGAAGACCATAAACTAAATGGCAA...

Protein

Download Protein FASTA

693 aa · LXL04_023702|LXL04_023702|OH1004|PROTEIN

MSILPSQNLGSSSSTSNLYAQNPNPNHGSNLPQPDSPSHPTHALQSLRITAPVDMPDRLTAESTAPTPETSGGISKKVKEDHKLNGKKIPDHQKSGQSSFGSSQQKGSRSNHQGGTPTSSGRKAQTVNGNHLLNFHYDPITRPQARPNPPRRLPKRKPYNKDLFLQANYKFVLLDSGNRAPESMDPDKMLQWEDIICLKYFTPHPTNCPICLEELLCPQMTSCGHIFCFPCILRYFLMGEDDDHKRESWKKCPLCFMMIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023702`
TK1151 ID	TkA06G238350
OH-1004 ID	LXL04_023702
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_023702`
Location	Chr05:63985408-63988440 (+)
Description	Similar to rnf10: RING finger protein 10
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023702` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006513 protein monoubiquitination Biological Process GO:0032790 ribosome disassembly Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0051865 protein autoubiquitination Biological Process GO:0070651 nonfunctional rRNA decay Biological Process GO:1990116 ribosome-associated ubiquitin-dependent protein catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0022626 cytosolic ribosome Cellular Component
KEGG gene cross-reference	bta:520757 hsa:9921 mmu:50849 rno:288710 xla:734904 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.471

Rank 1 · LXL04_023702 · OH-1004

Nucleus0.467

Rank 2 · LXL04_023702 · OH-1004

Cell membrane0.081

Rank 3 · LXL04_023702 · OH-1004

Golgi apparatus0.060

Rank 4 · LXL04_023702 · OH-1004

Lysosome / Vacuole0.056

Rank 5 · LXL04_023702 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00097.32zf-C3HC4208-255 aa

PF24921.2RING_XB3-XBAT31208-259 aa

PF13445.13zf-RING_UBOX208-252 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023702	`PF00097.32`	zf-C3HC4	208	255	3.1e-07	30.9
LXL04_023702	`PF24921.2`	RING_XB3-XBAT31	208	259	9.9e-07	29.4
LXL04_023702	`PF13445.13`	zf-RING_UBOX	208	252	7.2e-06	26.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card