LXL04_022678 | RubberDandelionOmics

Gene overview

LXL04_022678

Reference: OH-1004 Chr: Chr05 Coordinates: 4716355-4718836 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1143 bp · LXL04_022678|LXL04_022678|OH1004|cDNA

ATGGCGTCTTCACTTTCCCGTCATTTCTCAACTGCGTCACGAGATTCCATTTCTACCCATGGGTCAACAACTGTCTTCAACCACCACTCTCCACCTCTGTTCCTCCAGGTCCAGTATCCAACCAGTGGTGGAGCTCAGTTCTCTAAGTTCAAATGCTCCGCCGCGGGTTCTGAGACCGGGTTCTTCACGAAATTGGGGCGGTTAATAAAAGAGAAGGCGAAAAAGGACGTGGAAAAGATATTCTCTGGTGGTTTCTCGAA...

CDS

Download CDS FASTA

1143 bp · LXL04_022678|LXL04_022678|OH1004|CDS

ATGGCGTCTTCACTTTCCCGTCATTTCTCAACTGCGTCACGAGATTCCATTTCTACCCATGGGTCAACAACTGTCTTCAACCACCACTCTCCACCTCTGTTCCTCCAGGTCCAGTATCCAACCAGTGGTGGAGCTCAGTTCTCTAAGTTCAAATGCTCCGCCGCGGGTTCTGAGACCGGGTTCTTCACGAAATTGGGGCGGTTAATAAAAGAGAAGGCGAAAAAGGACGTGGAAAAGATATTCTCTGGTGGTTTCTCGAA...

Protein

Download Protein FASTA

380 aa · LXL04_022678|LXL04_022678|OH1004|PROTEIN

MASSLSRHFSTASRDSISTHGSTTVFNHHSPPLFLQVQYPTSGGAQFSKFKCSAAGSETGFFTKLGRLIKEKAKKDVEKIFSGGFSKTRDNLAVIDELLLYWNLSDTDRVLDELEEALLVSDFGPKITLKIVESLRDDIYAGKLKSGTEIKDALKNSVLDLLTKRGAKTELKLGFRKPAVIMIVGVNGGGKTTSLGKLAYRLKSEGASILMAAGDTFRAAASDQLEIWAERTGCEIVSAEKEKAKASSVLSQAVKKGKEQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022678`
TK1151 ID	TkA06G466240
OH-1004 ID	LXL04_022678
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022678

Location Chr05:4716355-4718836 (-)

Description Similar to CPFTSY: Cell division protein FtsY homolog, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45770`	Signal recognition particle receptor protein.	Involvement of a chloroplast homologue of the signal recognition particle receptor protein, FtsY, in protein targeting to thylakoids.1999 · DOI: 10.1016/s0014-5793(99)00305-1 Non-identical contributions of two membrane-bound cpSRP components, cpFtsY and Alb3, to thylakoid biogenesis.2008 · DOI: 10.1111/j.1365-313x.2008.03659.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022678 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006605 protein targeting Biological Process

GO:0006614 SRP-dependent cotranslational protein targeting to membrane Biological Process

GO:0009772 photosynthetic electron transport in photosystem II Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0045038 protein import into chloroplast thylakoid membrane Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

aae:aq_920

ath:AT2G45770

nma:NMA0291

nme:NMB0045

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.971

Rank 1 · LXL04_022678 · OH-1004

Mitochondrion0.041

Rank 2 · LXL04_022678 · OH-1004

Cytoplasm0.016

Rank 3 · LXL04_022678 · OH-1004

Nucleus0.015

Rank 4 · LXL04_022678 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_022678 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02881.25SRP54_N107-156 aa

PF00448.29SRP54178-379 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022678	`PF02881.25`	SRP54_N	107	156	2.5e-09	37.9
LXL04_022678	`PF00448.29`	SRP54	178	379	6e-73	245.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80842`	Arabidopsis thaliana	Cell division protein FtsY homolog, chloroplastic	81.050%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card