Gene Card
Gene overview
cDNA / CDS / Protein Sequences
408 bp · LXL04_022523|LXL04_022523|OH1004|cDNA
ATGCGGTTTGCAATCATGTTCCTCATCTCAACAGAGAACATCCCACAGGCGGAGGTGGAGATGGTGGAAAGCGCGCTGAGGGAAGCGGAGGTTGACACGTGTGAGTTTCAGTACGTGAAAAAGATCAAATCGTTGAACTTGTCTTTGGCATCGTCGTCTTTGAACGGGGCCAGCAGGAGCAACATTGTGGACTGGGCAGAGAAGCTGTACGGGCAGTCCATCAGTGCCGTGACTGCGGGGGTCAAGAATCTGCTATCAAG...
408 bp · LXL04_022523|LXL04_022523|OH1004|CDS
ATGCGGTTTGCAATCATGTTCCTCATCTCAACAGAGAACATCCCACAGGCGGAGGTGGAGATGGTGGAAAGCGCGCTGAGGGAAGCGGAGGTTGACACGTGTGAGTTTCAGTACGTGAAAAAGATCAAATCGTTGAACTTGTCTTTGGCATCGTCGTCTTTGAACGGGGCCAGCAGGAGCAACATTGTGGACTGGGCAGAGAAGCTGTACGGGCAGTCCATCAGTGCCGTGACTGCGGGGGTCAAGAATCTGCTATCAAG...
Protein
Download Protein FASTA135 aa · LXL04_022523|LXL04_022523|OH1004|PROTEIN
MRFAIMFLISTENIPQAEVEMVESALREAEVDTCEFQYVKKIKSLNLSLASSSLNGASRSNIVDWAEKLYGQSISAVTAGVKNLLSSDHQLAMARTVEALMEGKGKPNPEIDSYRGPPNPYLMWSKGPSKKGLCS
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_022523 |
|---|---|
| TK1151 ID | TkA05G474350 |
| OH-1004 ID | LXL04_022523 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 81.500 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_022523 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:152192553-152192960 (-) | ||||||||||||
| Description | Similar to SLY1: SEC1 family transport protein SLY1 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0001666 response to hypoxia Biological Process GO:0006886 intracellular protein transport Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process GO:0006892 post-Golgi vesicle-mediated transport Biological Process GO:0009636 response to toxic substance Biological Process GO:0016192 vesicle-mediated transport Biological Process GO:0051223 regulation of protein transport Biological Process GO:0060628 regulation of ER to Golgi vesicle-mediated transport Biological Process GO:1902902 negative regulation of autophagosome assembly Biological Process GO:0000139 Golgi membrane Cellular Component GO:0005739 mitochondrion Cellular Component | ||||||||||||
| KEGG gene cross-reference | ath:AT2G17980 ddi:DDB_G0288719 dme:Dmel_CG3539 dosa:Os03g0620800 hsa:23256 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.