LXL04_021159 | RubberDandelionOmics

Gene overview

LXL04_021159

Reference: OH-1004 Chr: Chr04 Coordinates: 122889272-122898010 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3765 bp · LXL04_021159|LXL04_021159|OH1004|cDNA

ATGTGGAGAAGAAGAGTTTTCACTTTGGTCCGATACTTCTCTTCTGAACCAGAAACCCCATCTCCTCCTTCCGTTTATTCCTTCCTCCAGCCTTCAATCTTTGCCGTAAGAAAACCTCAATCCAAACAAGCTCCCGAGTCTAACAATCAAACCCCCAAACCTGTAGCCGTAGATAACCAACTTACCCCCAATCTCGAATCCACTCTCCAATTATCTCTTCACGAAAATAACACAGACGAAGCTTGGAAGTGCTTCAAATC...

CDS

Download CDS FASTA

3765 bp · LXL04_021159|LXL04_021159|OH1004|CDS

ATGTGGAGAAGAAGAGTTTTCACTTTGGTCCGATACTTCTCTTCTGAACCAGAAACCCCATCTCCTCCTTCCGTTTATTCCTTCCTCCAGCCTTCAATCTTTGCCGTAAGAAAACCTCAATCCAAACAAGCTCCCGAGTCTAACAATCAAACCCCCAAACCTGTAGCCGTAGATAACCAACTTACCCCCAATCTCGAATCCACTCTCCAATTATCTCTTCACGAAAATAACACAGACGAAGCTTGGAAGTGCTTCAAATC...

Protein

Download Protein FASTA

1254 aa · LXL04_021159|LXL04_021159|OH1004|PROTEIN

MWRRRVFTLVRYFSSEPETPSPPSVYSFLQPSIFAVRKPQSKQAPESNNQTPKPVAVDNQLTPNLESTLQLSLHENNTDEAWKCFKSLSSSSSSLLPSKPLINSLITHLCSVRNDTHNLKRAFATLMFVLEANPEVLEHKTVETFLISMKVTNGAPAFALVKSMFKNRYFVPFSIWGNTLVEISRKTGRFCDFLEAFNENCRIAKEEKLDSLKPDLSACNAALEGCCHELESVTDAHKVLDIMSLLGVRPNETTFGYLAY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021159`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021159

Location Chr04:122889272-122898010 (+)

Description Similar to PAP1: Probable inactive purple acid phosphatase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13750`	Probable inactive purple acid phosphatase 1.	No verified direct reference in this release
`At5g50400`	Probable inactive purple acid phosphatase 27.	No verified direct reference in this release
`At4g24890`	Probable inactive purple acid phosphatase 24.	No verified direct reference in this release
`At1g69290`	Pentatricopeptide repeat-containing protein At1g69290.	No verified direct reference in this release
`At1g68980`	Pentatricopeptide repeat-containing protein At1g68980, mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021159 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003993 acid phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G13750

ath:AT1G68980

ath:AT1G69290

ath:AT4G24890

ath:AT5G50400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.773

Rank 1 · LXL04_021159 · OH-1004

Golgi apparatus0.054

Rank 2 · LXL04_021159 · OH-1004

Cell membrane0.049

Rank 3 · LXL04_021159 · OH-1004

Lysosome / Vacuole0.046

Rank 4 · LXL04_021159 · OH-1004

Cytoplasm0.045

Rank 5 · LXL04_021159 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25245.1TPR_At1g6898059-213 aa

PF23276.3TPR_24371-461 aa

PF29070.1MSC6_N473-565 aa

PF13041.13PPR_2509-552 aa

PF01535.27PPR509-533 aa

PF12854.14PPR_1509-533 aa

PF17808.8fn3_PAP689-807 aa

PF16656.12Pur_ac_phosph_N811-918 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021159	`PF25245.1`	TPR_At1g68980	59	213	2.3e-62	210.4
LXL04_021159	`PF23276.3`	TPR_24	371	461	2.3e-13	50.9
LXL04_021159	`PF29070.1`	MSC6_N	473	565	2.2e-09	37.6
LXL04_021159	`PF13041.13`	PPR_2	509	552	6.4e-32	110.1
LXL04_021159	`PF01535.27`	PPR	509	533	4.2e-26	90.0
LXL04_021159	`PF12854.14`	PPR_1	509	533	1.8e-12	47.5
LXL04_021159	`PF17808.8`	fn3_PAP	689	807	4.9e-39	133.8
LXL04_021159	`PF16656.12`	Pur_ac_phosph_N	811	918	8.1e-12	46.3
LXL04_021159	`PF00149.34`	Metallophos	931	1145	1.4e-16	62.3
LXL04_021159	`PF14008.12`	Metallophos_C	1170	1229	8.1e-16	59.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMX4`	Arabidopsis thaliana	Probable inactive purple acid phosphatase 1	72.268%	Swiss-Prot	weak database homology
`Q5MAU8`	Arabidopsis thaliana	Probable inactive purple acid phosphatase 27	67.875%	Swiss-Prot	weak database homology
`Q8H1R2`	Arabidopsis thaliana	Probable inactive purple acid phosphatase 24	64.657%	Swiss-Prot	weak database homology
`P0C7R4`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g69290	57.566%	Swiss-Prot	moderate database homology
`Q9CAA5`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g68980, mitochondrial	54.003%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card