LXL04_020560 | RubberDandelionOmics

Gene overview

LXL04_020560

Reference: OH-1004 Chr: Chr04 Coordinates: 89947331-89952202 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2043 bp · LXL04_020560|LXL04_020560|OH1004|cDNA

ATGGAAGCATCTCAAAGCGGATCAGAACGAGAGAAGTCAAAGCCGCCATCAACTTCTCCACCGATTCCTTCTGTTGCTAATTTCTGGAGAGAGTTTGATTTGGAGAAGGAAAGGAGTATATTAGACGAACAAGGGCTTAGAATTGCTGAAAATCAGGAAAACAGCCAGAAGAACCGCCGGAAACTTGCAGAGAGCACCCGAGATTTCAAGAAAGCTCCAGCTGAAGAAAAGTCCAGCTTGTTCACTTCCTTACTCAGAGG...

CDS

Download CDS FASTA

2043 bp · LXL04_020560|LXL04_020560|OH1004|CDS

ATGGAAGCATCTCAAAGCGGATCAGAACGAGAGAAGTCAAAGCCGCCATCAACTTCTCCACCGATTCCTTCTGTTGCTAATTTCTGGAGAGAGTTTGATTTGGAGAAGGAAAGGAGTATATTAGACGAACAAGGGCTTAGAATTGCTGAAAATCAGGAAAACAGCCAGAAGAACCGCCGGAAACTTGCAGAGAGCACCCGAGATTTCAAGAAAGCTCCAGCTGAAGAAAAGTCCAGCTTGTTCACTTCCTTACTCAGAGG...

Protein

Download Protein FASTA

680 aa · LXL04_020560|LXL04_020560|OH1004|PROTEIN

MEASQSGSEREKSKPPSTSPPIPSVANFWREFDLEKERSILDEQGLRIAENQENSQKNRRKLAESTRDFKKAPAEEKSSLFTSLLRGYQEEVDNLTKRAKFGENAFLNIYQKLYEAPDPYPVVASVADKDLKICDLESDNRKMKVELEEFRTEATHLKNQQATIRRLEDRTRQLEQQMEEKVKEIVEMKQRSLAEENQKTLEVLKEREQLLQDQLRHAQDSVSNMQMLHEIAQSKLFEYRAQSEEDGAAKQTEVNLLMDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020560`
TK1151 ID	TkA05G231490
OH-1004 ID	LXL04_020560
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020560

Location Chr04:89947331-89952202 (+)

Description Similar to CASP: Protein CASP

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18480`	May be involved in intra-Golgi transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020560 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000301 retrograde transport, vesicle recycling within Golgi Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

KEGG gene cross-reference

ath:AT3G18480

hsa:1523

pon:100171552

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.609

Rank 1 · LXL04_020560 · OH-1004

Cytoplasm0.397

Rank 2 · LXL04_020560 · OH-1004

Endoplasmic reticulum0.135

Rank 3 · LXL04_020560 · OH-1004

Nucleus0.093

Rank 4 · LXL04_020560 · OH-1004

Cell membrane0.074

Rank 5 · LXL04_020560 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25398.2CUX1_N22-129 aa

PF08172.18CASP_C435-657 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020560	`PF25398.2`	CUX1_N	22	129	1.9e-40	138.1
LXL04_020560	`PF08172.18`	CASP_C	435	657	5.4e-60	203.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LS42`	Arabidopsis thaliana	Protein CASP	74.964%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card