LXL04_020300 | RubberDandelionOmics

Gene overview

LXL04_020300

Reference: OH-1004 Chr: Chr04 Coordinates: 64726872-64740192 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5186 bp · LXL04_020300|LXL04_020300|OH1004|cDNA

ATGGAGTCTACGAAGACAGCAATGGAGGCTTTCGAGAAGCTAGAGAAGGTTGGAGAAGGAACCTATGGCAAAGTGTACAGAGCGAGAGACAGAGCCACTGGAAGTCCCTACAACACTTCGAGAGATCTCGGTTTTGAGAATGCTCTCCGAACAGGTGTAATGGAGGATTCGGCCACCATCACCGAATGTTTACTCCTCTCCGAGCTCCAATCGTCCTCGGATCTCTCCTCCATCTACCACCTTTTCTCCTCGTACCTTCA...

CDS

Download CDS FASTA

5034 bp · LXL04_020300|LXL04_020300|OH1004|CDS

ATGGAGTCTACGAAGACAGCAATGGAGGCTTTCGAGAAGCTAGAGAAGGTTGGAGAAGGAACCTATGGCAAAGTGTACAGAGCGAGAGACAGAGCCACTGGAAGTCCCTACAACACTTCGAGAGATCTCGGTTTTGAGAATGCTCTCCGAACAGGTGTAATGGAGGATTCGGCCACCATCACCGAATGTTTACTCCTCTCCGAGCTCCAATCGTCCTCGGATCTCTCCTCCATCTACCACCTTTTCTCCTCGTACCTTCA...

Protein

Download Protein FASTA

1677 aa · LXL04_020300|LXL04_020300|OH1004|PROTEIN

MESTKTAMEAFEKLEKVGEGTYGKVYRARDRATGSPYNTSRDLGFENALRTGVMEDSATITECLLLSELQSSSDLSSIYHLFSSYLHPFTAIINKPKKQSKPSEINAKASTIIHSLAKKFTSFLNKALNLIPKRLNETPKIESCYASELFEAYKLCLSCLESIMSALSCKPHYVQFQRLRLIHCYQVWGRYEDAQNEGFSLLEYIWKLWGERGGNLKREVIPQLTKENGDKDVAMLILDVVVTHCNCVLNGRSKDNEVYR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020300`
TK1151 ID	TkA05G163600
OH-1004 ID	LXL04_020300
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.400
Protein coverage (%)	TK1151 78.845 / OH-1004 96.780 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020300

Location Chr04:64726872-64740192 (+)

Description Similar to ESP1: Separase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g22970`	Cleaves SYN1, releasing sister chromatid cohesion.	Arabidopsis separase AESP is essential for embryo development and the release of cohesin during meiosis.2006 · DOI: 10.1105/tpc.105.036913 A conditional mutation in Arabidopsis thaliana separase induces chromosome non-disjunction, aberrant morphogenesis and cyclin B1;1 stability.2010 · DOI: 10.1242/dev.041939 The radially swollen 4 separase mutation of Arabidopsis thaliana blocks chromosome disjunction and disrupts the radial microtubule system in meiocytes.2011 · DOI: 10.1371/journal.pone.0019459
`At1g20930`	Cyclin-dependent kinase B2-2.	No verified direct reference in this release
`At1g76540`	Cyclin-dependent kinase B2-1.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0897000`	Cyclin-dependent kinase B1-1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020300 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000086 G2/M transition of mitotic cell cycle Biological Process

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0006508 proteolysis Biological Process

GO:0006887 exocytosis Biological Process

GO:0007165 signal transduction Biological Process

GO:0007346 regulation of mitotic cell cycle Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009934 regulation of meristem structural organization Biological Process

GO:0009960 endosperm development Biological Process

GO:0010389 regulation of G2/M transition of mitotic cell cycle Biological Process

KEGG gene cross-reference

ath:AT1G20930

ath:AT1G76540

ath:AT4G22970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.598

Rank 1 · LXL04_020300 · OH-1004

Cytoplasm0.336

Rank 2 · LXL04_020300 · OH-1004

Cell membrane0.077

Rank 3 · LXL04_020300 · OH-1004

Endoplasmic reticulum0.053

Rank 4 · LXL04_020300 · OH-1004

Golgi apparatus0.044

Rank 5 · LXL04_020300 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25110.2TPR_ESP164-342 aa

PF25113.2TPR_ESP1_2nd353-472 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020300	`PF25110.2`	TPR_ESP1	64	342	7.7e-99	330.9
LXL04_020300	`PF25113.2`	TPR_ESP1_2nd	353	472	1.4e-30	107.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5IBC5`	Arabidopsis thaliana	Separase	36.126%	Swiss-Prot	moderate database homology
`Q8LG64`	Arabidopsis thaliana	Cyclin-dependent kinase B2-2	89.655%	Swiss-Prot	weak database homology
`Q8LF80`	Arabidopsis thaliana	Cyclin-dependent kinase B2-1	86.207%	Swiss-Prot	weak database homology
`Q8L4P8`	Oryza sativa subsp. japonica	Cyclin-dependent kinase B1-1	82.143%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card