LXL04_020004 | RubberDandelionOmics

Gene overview

LXL04_020004

Reference: OH-1004 Chr: Chr04 Coordinates: 47263720-47264493 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

774 bp · LXL04_020004|LXL04_020004|OH1004|cDNA

ATGTCCGGTTTCCAGGATCGACACGACGATGATGATTCGCCATTTTGGCCTCCTGGGAACTCAACCGATGCCAATAGTAGGATCTTGCTCATTGCTATTATATCGTTATCTGTAGTGGTTGTGGTTGTGACCATGTTACATGTATACGCAAGGTACATGCTCCGCCGCCAAGCCCACCACCGAGCAGCTCTACGAGGTATCGGAATCGTAGCCCGGATCGACTCAGACGATCCACCTAAAAGGGGTCTTGAACCCACTGT...

CDS

Download CDS FASTA

774 bp · LXL04_020004|LXL04_020004|OH1004|CDS

ATGTCCGGTTTCCAGGATCGACACGACGATGATGATTCGCCATTTTGGCCTCCTGGGAACTCAACCGATGCCAATAGTAGGATCTTGCTCATTGCTATTATATCGTTATCTGTAGTGGTTGTGGTTGTGACCATGTTACATGTATACGCAAGGTACATGCTCCGCCGCCAAGCCCACCACCGAGCAGCTCTACGAGGTATCGGAATCGTAGCCCGGATCGACTCAGACGATCCACCTAAAAGGGGTCTTGAACCCACTGT...

Protein

Download Protein FASTA

257 aa · LXL04_020004|LXL04_020004|OH1004|PROTEIN

MSGFQDRHDDDDSPFWPPGNSTDANSRILLIAIISLSVVVVVVTMLHVYARYMLRRQAHHRAALRGIGIVARIDSDDPPKRGLEPTVIASLPMLMYKDVDHKLDHNSGDQSPECTVCLSTFEGGQMIRVLPSCKHHFHAECIDKWLGSQSSCPVCRHEVIEAGGDGGSVMPLPREPSTRVGLGLGLGLLPASAPPLERPGSVEIAVEGTSDQMVQLSEKVNGTNSRLSSFRRMLSMDRSSRRVNSCTQDGNEDLERQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020004`
TK1151 ID	TkA05G116880
OH-1004 ID	LXL04_020004
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 79.767 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020004

Location Chr04:47263720-47264493 (-)

Description Similar to ATL41: E3 ubiquitin-protein ligase ATL41

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g42360`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8, UBC10, UBC11, UBC28, UBC29, UBC30, UBC35 and UBC36 in vitro.	No verified direct reference in this release
`At2g42350`	RING-H2 finger protein ATL40.	No verified direct reference in this release
`At3g16720`	May be involved in the early steps of the plant defense signaling pathway.	No verified direct reference in this release
`At3g62690`	RING-H2 finger protein ATL5.	No verified direct reference in this release
`At1g20823`	May be involved in the early steps of the plant defense signaling pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020004 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0010966 regulation of phosphate transport Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:0070417 cellular response to cold Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G20823

ath:AT2G42350

ath:AT2G42360

ath:AT3G16720

ath:AT3G62690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.294

Rank 1 · LXL04_020004 · OH-1004

Cell membrane0.261

Rank 2 · LXL04_020004 · OH-1004

Cytoplasm0.235

Rank 3 · LXL04_020004 · OH-1004

Endoplasmic reticulum0.226

Rank 4 · LXL04_020004 · OH-1004

Golgi apparatus0.194

Rank 5 · LXL04_020004 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2113-156 aa

PF17123.12zf-RING_11113-142 aa

PF13923.13zf-C3HC4_2113-155 aa

PF12861.14zf-ANAPC11120-159 aa

PF12678.14zf-rbx1125-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020004	`PF13639.13`	zf-RING_2	113	156	3.5e-15	56.7
LXL04_020004	`PF17123.12`	zf-RING_11	113	142	1.1e-10	41.7
LXL04_020004	`PF13923.13`	zf-C3HC4_2	113	155	2e-09	37.8
LXL04_020004	`PF12861.14`	zf-ANAPC11	120	159	5.5e-07	30.2
LXL04_020004	`PF12678.14`	zf-rbx1	125	156	6.2e-09	36.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SLC3`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL41	41.569%	Swiss-Prot	moderate database homology
`Q9SLC4`	Arabidopsis thaliana	RING-H2 finger protein ATL40	36.538%	Swiss-Prot	moderate database homology
`Q8L9T5`	Arabidopsis thaliana	RING-H2 finger protein ATL2	31.522%	Swiss-Prot	moderate database homology
`Q9LZJ6`	Arabidopsis thaliana	RING-H2 finger protein ATL5	37.324%	Swiss-Prot	moderate database homology
`Q9LM69`	Arabidopsis thaliana	RING-H2 finger protein ATL80	35.811%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card