LXL04_019744 | RubberDandelionOmics

Gene overview

LXL04_019744

Reference: OH-1004 Chr: Chr04 Coordinates: 38973235-38976831 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1269 bp · LXL04_019744|LXL04_019744|OH1004|cDNA

ATGCAAACACCATTGTTGTTCAACGTGACCACCGGCTCCAGCACCAAAAGACCTGCTTCTTCCTACTCTACTCCACAAAAATTTCACAGACATCACTCTTCAGAAATCAATGGAGCTCTGTGGAGCTTCTGCCTTGGCTTGGAGAACCTCAATTTCTCCTTCTCTCCACTTTTCTCCTCAACCGACTTCGGTCCCATCTCTTTCTGGATTTGTATTACGTCGTTAAAATTAATTTGTTGTGCTAAGTTTTCCTTGCTGTT...

CDS

Download CDS FASTA

1269 bp · LXL04_019744|LXL04_019744|OH1004|CDS

ATGCAAACACCATTGTTGTTCAACGTGACCACCGGCTCCAGCACCAAAAGACCTGCTTCTTCCTACTCTACTCCACAAAAATTTCACAGACATCACTCTTCAGAAATCAATGGAGCTCTGTGGAGCTTCTGCCTTGGCTTGGAGAACCTCAATTTCTCCTTCTCTCCACTTTTCTCCTCAACCGACTTCGGTCCCATCTCTTTCTGGATTTGTATTACGTCGTTAAAATTAATTTGTTGTGCTAAGTTTTCCTTGCTGTT...

Protein

Download Protein FASTA

422 aa · LXL04_019744|LXL04_019744|OH1004|PROTEIN

MQTPLLFNVTTGSSTKRPASSYSTPQKFHRHHSSEINGALWSFCLGLENLNFSFSPLFSSTDFGPISFWICITSLKLICCAKFSLLFQVCEFRRVRVWCVKTDANGSSQSLKGNQMTVSITGATGFIGSKLVQRLYEDNHSICVLTRSRSKAQSIFPVKDFPGIVIAEEAQWKECIEGSTGVVNLAGLPISTRWSPEVKKEIKESRVRVTSKVVDLINKSPSDSRPKVLVSATAVGYYGTSETQVFDEQSPSGNDYLAEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019744`
TK1151 ID	TkA05G082340
OH-1004 ID	LXL04_019744
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.100
Protein coverage (%)	TK1151 92.521 / OH-1004 79.147 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019744

Location Chr04:38973235-38976831 (-)

Description Similar to GC1: Epimerase family protein SDR39U1 homolog, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g21280`	Putative NADP-dependent oxidoreductase that acts as a positive regulator of chloroplast division.	GIANT CHLOROPLAST 1 is essential for correct plastid division in Arabidopsis.2004 · DOI: 10.1016/j.cub.2004.04.031

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019744 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010020 chloroplast fission Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT2G21280

ecj:JW2301

eco:b2304

ecoc:C3026_12850

hsa:56948

mmu:654795

syn:slr1223

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.970

Rank 1 · LXL04_019744 · OH-1004

Mitochondrion0.044

Rank 2 · LXL04_019744 · OH-1004

Cytoplasm0.022

Rank 3 · LXL04_019744 · OH-1004

Nucleus0.018

Rank 4 · LXL04_019744 · OH-1004

Peroxisome0.015

Rank 5 · LXL04_019744 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01370.28Epimerase119-335 aa

PF08338.17DUF1731369-415 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019744	`PF01370.28`	Epimerase	119	335	6.7e-22	78.8
LXL04_019744	`PF08338.17`	DUF1731	369	415	3e-18	66.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJU9`	Arabidopsis thaliana	Epimerase family protein SDR39U1 homolog, chloroplastic	77.576%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card