LXL04_019035 | RubberDandelionOmics

Gene overview

LXL04_019035

Reference: OH-1004 Chr: Chr04 Coordinates: 22415730-22419379 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1917 bp · LXL04_019035|LXL04_019035|OH1004|cDNA

AACCGCCAATGTGGAACGTGGTTATCCGTTTACCTGTCGGTCTGTCCCTACCACCCGGATCCCATTATCAATGTTATTCCAATACTACCCTCCAATATTACGATAAGATCATCTAATAAAATTAAAGGAGAATTATAGATTGAGCTTTTCAACTGTAGAGAGAAAATGGACAGCACTTTGGAGTCGATGAAGGATGGAGAGTCCACCGTTGGTGGTGGCGTTGAGGACGTCTACGGTGAAGATCGTGCAACCGAGGACCA...

CDS

Download CDS FASTA

1752 bp · LXL04_019035|LXL04_019035|OH1004|CDS

ATGGACAGCACTTTGGAGTCGATGAAGGATGGAGAGTCCACCGTTGGTGGTGGCGTTGAGGACGTCTACGGTGAAGATCGTGCAACCGAGGACCAACTCGTCACGCCTTGGACTACTTCCGTCGCTAGTGGATACACTTTGATGAGAGATCCACGCCATAACAAGGGGCTGGCGTTCACCGAGAGGGAAAGAGATTCTCATTACTTACGTGGTCTGTTGCCTCCGGCTATTTCAACACAGGAGCTTCAGGAAAAGAAATT...

Protein

Download Protein FASTA

583 aa · LXL04_019035|LXL04_019035|OH1004|PROTEIN

MDSTLESMKDGESTVGGGVEDVYGEDRATEDQLVTPWTTSVASGYTLMRDPRHNKGLAFTERERDSHYLRGLLPPAISTQELQEKKLMQSIRNYEVPLHKYVAMMELEERNERLFYKLLIDHVEELLPIVYTPTVGEACQKYGSIFKRPQGLYISLKEKGKILEVLRNWPERSIQVIVVTDGERILGLGDLGCQGMGIPVGKLALYTALGGVRPSACLPITIDVGTNNQKLLDDEFYIGLKQRRTTGKEYYELLEEFMSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019035`
TK1151 ID	TkA05G012810
OH-1004 ID	LXL04_019035
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	98.500
Protein coverage (%)	TK1151 97.751 / OH-1004 81.990 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_019035`
Location	Chr04:22415730-22419379 (+)
Description	Similar to NADP-dependent malic enzyme
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019035` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006108 malate metabolic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0009507 chloroplast Cellular Component GO:0004473 malate dehydrogenase (decarboxylating) (NADP+) activity Molecular Function GO:0008948 oxaloacetate decarboxylase activity Molecular Function GO:0046872 metal ion binding Molecular Function GO:0051287 NAD binding Molecular Function
KEGG gene cross-reference	vvi:100233140 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.762

Rank 1 · LXL04_019035 · OH-1004

Nucleus0.214

Rank 2 · LXL04_019035 · OH-1004

Mitochondrion0.085

Rank 3 · LXL04_019035 · OH-1004

Plastid0.060

Rank 4 · LXL04_019035 · OH-1004

Peroxisome0.060

Rank 5 · LXL04_019035 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00390.25malic109-289 aa

PF03949.22Malic_M299-552 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019035	`PF00390.25`	malic	109	289	2.7e-79	266.0
LXL04_019035	`PF03949.22`	Malic_M	299	552	1.3e-96	323.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card