LXL04_018902 | RubberDandelionOmics

Gene overview

LXL04_018902

Reference: OH-1004 Chr: Chr04 Coordinates: 19885770-19888231 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1161 bp · LXL04_018902|LXL04_018902|OH1004|cDNA

ATGGGTAAACTCAGTCTCCAAGGGAACACTTGTCAAAACCTCAGTGGACCACGTAGATATCTGACAAGACAAATGGTAAAATGTCAGGCAGAAGATGTTTTCCATGGGGTGAGCAGAAACCGAACCGCATTACCGAATTATCGAAAAAATcgcaaaaaccgaaccgcaaTTACCGAAACCGATACAAAAACCGCATTTACCGAAACCGCAAAATTGCGGTGCGGTTCGTCTCCGCCTCTCCCCATCTGCTCCTCGCACAC...

CDS

Download CDS FASTA

1161 bp · LXL04_018902|LXL04_018902|OH1004|CDS

ATGGGTAAACTCAGTCTCCAAGGGAACACTTGTCAAAACCTCAGTGGACCACGTAGATATCTGACAAGACAAATGGTAAAATGTCAGGCAGAAGATGTTTTCCATGGGGTGAGCAGAAACCGAACCGCATTACCGAATTATCGAAAAAATCGCAAAAACCGAACCGCAATTACCGAAACCGATACAAAAACCGCATTTACCGAAACCGCAAAATTGCGGTGCGGTTCGTCTCCGCCTCTCCCCATCTGCTCCTCGCACAC...

Protein

Download Protein FASTA

386 aa · LXL04_018902|LXL04_018902|OH1004|PROTEIN

MGKLSLQGNTCQNLSGPRRYLTRQMVKCQAEDVFHGVSRNRTALPNYRKNRKNRTAITETDTKTAFTETAKLRCGSSPPLPICSSHTVHTVNTAINCSDSQRHAAPTSPPVTSPSPTSARVLRSPLIVEESASHTATHSEHSDTQSPPCSAIASLLRRPLPAPTSPPCSAPLSRRTTTGGNLHQSVNQNLHLSPTYVKPCDNHTLMDVDHDELDVSPVNIIRNSEQVKDISTPLRSSQPASDDGLEVIDICSSPLASEEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018902`
TK1151 ID	TkA05G003660
OH-1004 ID	LXL04_018902
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	71.100
Protein coverage (%)	TK1151 98.762 / OH-1004 98.187 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018902

Location Chr04:19885770-19888231 (-)

Description Similar to PMS1: DNA mismatch repair protein PMS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02460`	Required for DNA mismatch repair (MMR), correcting base-base mismatches and insertion-deletion loops (IDLs) resulting from DNA replication, DNA damage or from recombination events between non- identical sequences during meiosis.	Involvement of the Arabidopsis thaliana AtPMS1 gene in somatic repeat instability.2004 · DOI: 10.1007/s11103-004-3472-0 The Arabidopsis DNA mismatch repair gene PMS1 restricts somatic recombination between homeologous sequences.2009 · DOI: 10.1007/s11103-008-9447-9 Yeast mutator phenotype enforced by Arabidopsis PMS1 expression.2013 · DOI: 10.1007/s11033-012-2269-5

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018902 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006298 mismatch repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0009555 pollen development Biological Process

GO:0010154 fruit development Biological Process

GO:0048316 seed development Biological Process

GO:0005634 nucleus Cellular Component

GO:0032389 MutLalpha complex Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0030983 mismatched DNA binding Molecular Function

GO:0140664 ATP-dependent DNA damage sensor activity Molecular Function

KEGG gene cross-reference

ath:AT4G02460

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.865

Rank 1 · LXL04_018902 · OH-1004

Cytoplasm0.237

Rank 2 · LXL04_018902 · OH-1004

Mitochondrion0.038

Rank 3 · LXL04_018902 · OH-1004

Cell membrane0.024

Rank 4 · LXL04_018902 · OH-1004

Golgi apparatus0.013

Rank 5 · LXL04_018902 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q941I6`	Arabidopsis thaliana	DNA mismatch repair protein PMS1	35.862%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card