LXL04_017426 | RubberDandelionOmics

Gene overview

LXL04_017426

Reference: OH-1004 Chr: Chr03 Coordinates: 148752719-148754476 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1758 bp · LXL04_017426|LXL04_017426|OH1004|cDNA

ATGGCGTCTCTAATGGCGATTCGCAGAAGCACCTTCGCTTCTTCCTTCAGGGTAACTTCTTTACGCTCATCTCATTCCATTTTCAACCGTGACACCCTCAGAACTCTCTCCACATCGACCGCCCCAAACAGCTTCGATTCGCCCCCAAATGATCGAACGAACTCTAACCAATGGAATCTGCAACAAAATCATCCGCAAGGGAACCCCAATCCGTGGGATAATCGGAATCAGGGATATCCGAATCCACCAAATGCTGGTCA...

CDS

Download CDS FASTA

1758 bp · LXL04_017426|LXL04_017426|OH1004|CDS

ATGGCGTCTCTAATGGCGATTCGCAGAAGCACCTTCGCTTCTTCCTTCAGGGTAACTTCTTTACGCTCATCTCATTCCATTTTCAACCGTGACACCCTCAGAACTCTCTCCACATCGACCGCCCCAAACAGCTTCGATTCGCCCCCAAATGATCGAACGAACTCTAACCAATGGAATCTGCAACAAAATCATCCGCAAGGGAACCCCAATCCGTGGGATAATCGGAATCAGGGATATCCGAATCCACCAAATGCTGGTCA...

Protein

Download Protein FASTA

585 aa · LXL04_017426|LXL04_017426|OH1004|PROTEIN

MASLMAIRRSTFASSFRVTSLRSSHSIFNRDTLRTLSTSTAPNSFDSPPNDRTNSNQWNLQQNHPQGNPNPWDNRNQGYPNPPNAGQQNTYSVNPNQRQNYPPNTGQQNHYQEYPNQRQNYPPVTGGQNFYQENPNQRQNYPSNEARQSSYQTNTNQRPNYPPQPPIQRQNFQQHQPSNYSPPNPNPGQSNIPRSPSAWNNDQAHGANSQASSTKVDLLKICKEGKLKEAIELMDKGELADAECFNALFSLCGKFKKLED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017426`
TK1151 ID	TkA02G044820
OH-1004 ID	LXL04_017426
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017426

Location Chr03:148752719-148754476 (-)

Description Similar to PCMP-H66: Pentatricopeptide repeat-containing protein At2g15690, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g15690`	Pentatricopeptide repeat-containing protein At2g15690, mitochondrial.	No verified direct reference in this release
`At4g32450`	Pentatricopeptide repeat-containing protein At4g32450, mitochondrial.	No verified direct reference in this release
`At2g25580`	Pentatricopeptide repeat-containing protein At2g25580.	No verified direct reference in this release
`At3g24000`	Pentatricopeptide repeat-containing protein At3g24000, mitochondrial.	No verified direct reference in this release
`At1g56690`	Pentatricopeptide repeat-containing protein At1g56690, mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017426 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009451 RNA modification Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G15690

ath:AT2G25580

ath:AT3G24000

ath:AT4G32450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.590

Rank 1 · LXL04_017426 · OH-1004

Plastid0.314

Rank 2 · LXL04_017426 · OH-1004

Nucleus0.078

Rank 3 · LXL04_017426 · OH-1004

Cytoplasm0.050

Rank 4 · LXL04_017426 · OH-1004

Cell membrane0.014

Rank 5 · LXL04_017426 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_2308-354 aa

PF01535.27PPR310-339 aa

PF17177.11PPR_long325-400 aa

PF14432.13DYW_deaminase494-585 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017426	`PF13041.13`	PPR_2	308	354	1.2e-16	61.2
LXL04_017426	`PF01535.27`	PPR	310	339	4.2e-18	65.0
LXL04_017426	`PF17177.11`	PPR_long	325	400	2.3e-06	27.9
LXL04_017426	`PF14432.13`	DYW_deaminase	494	585	5.5e-44	148.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQE5`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g15690, mitochondrial	45.192%	Swiss-Prot	moderate database homology
`Q9SUU7`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g32450, mitochondrial	33.457%	Swiss-Prot	moderate database homology
`Q680H3`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g25580	38.817%	Swiss-Prot	moderate database homology
`Q9LIQ7`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At3g24000, mitochondrial	36.757%	Swiss-Prot	moderate database homology
`Q9FXB9`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g56690, mitochondrial	36.043%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card