LXL04_016490 | RubberDandelionOmics

Gene overview

LXL04_016490

Reference: OH-1004 Chr: Chr03 Coordinates: 124770764-124773800 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1563 bp · LXL04_016490|LXL04_016490|OH1004|cDNA

ATGGTTAAGAAGAAAGAGAGGTCCGTGAACGTTTCGGGAAAGCCAAAGCACTCTCTCGATGTCAACAGAGATGCCGGCAACAAGAACAAAAGCGGCGGCACCGCCCGTACCTCCGCCACCGTTCGTCGTCTTAAGATGTACAAGACGAGGCCGAAGCGTGACTCCAAAGGAACCATTCTCAAACACGAATTGCAGTCAAAGGAGTTGCCTTCTACTCGTATACAACCTGATCGCCGCTGGTTCGGTAACACAAGAGTAGT...

CDS

Download CDS FASTA

1563 bp · LXL04_016490|LXL04_016490|OH1004|CDS

ATGGTTAAGAAGAAAGAGAGGTCCGTGAACGTTTCGGGAAAGCCAAAGCACTCTCTCGATGTCAACAGAGATGCCGGCAACAAGAACAAAAGCGGCGGCACCGCCCGTACCTCCGCCACCGTTCGTCGTCTTAAGATGTACAAGACGAGGCCGAAGCGTGACTCCAAAGGAACCATTCTCAAACACGAATTGCAGTCAAAGGAGTTGCCTTCTACTCGTATACAACCTGATCGCCGCTGGTTCGGTAACACAAGAGTAGT...

Protein

Download Protein FASTA

520 aa · LXL04_016490|LXL04_016490|OH1004|PROTEIN

MVKKKERSVNVSGKPKHSLDVNRDAGNKNKSGGTARTSATVRRLKMYKTRPKRDSKGTILKHELQSKELPSTRIQPDRRWFGNTRVVNQKELEFFREELQSRLSSNYNVIMKERKLPMSLLNDHQKQARVHLLDTEPFADAFGPKGKRKRPKLVASDYESLLKRADGSHDAFEEKHGDEPEDPNADGFRDLVRHTMFEKGQSKRIWGELYKVIDSSDVIIQVLDARDPQGTRCRHLEKHLKEHCKHKHMILLLNKCDLTP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016490`
TK1151 ID	TkA02G134640
OH-1004 ID	LXL04_016490
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016490

Location Chr03:124770764-124773800 (+)

Description Similar to NUG2: Nuclear/nucleolar GTPase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g52980`	GTPase involved in pre-60S ribosomal subunit maturation.	Nuclear/nucleolar GTPase 2 proteins as a subfamily of YlqF/YawG GTPases function in pre-60S ribosomal subunit maturation of mono- and dicotyledonous plants.2011 · DOI: 10.1074/jbc.m110.200816

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0352400`	GTPase involved in pre-60S ribosomal subunit maturation.	Nuclear/nucleolar GTPase 2 proteins as a subfamily of YlqF/YawG GTPases function in pre-60S ribosomal subunit maturation of mono- and dicotyledonous plants.2011 · DOI: 10.1074/jbc.m110.200816
`UniProt: A2XGQ1`	GTPase involved in pre-60S ribosomal subunit maturation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016490 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0042254 ribosome biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0016020 membrane Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G52980

dosa:Os03g0352400

hsa:29889

mmu:230737

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.749

Rank 1 · LXL04_016490 · OH-1004

Cytoplasm0.212

Rank 2 · LXL04_016490 · OH-1004

Mitochondrion0.060

Rank 3 · LXL04_016490 · OH-1004

Cell membrane0.042

Rank 4 · LXL04_016490 · OH-1004

Endoplasmic reticulum0.017

Rank 5 · LXL04_016490 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08153.18NGP1NT46-171 aa

PF02421.25FeoB_N311-374 aa

PF01926.30MMR_HSR1312-377 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016490	`PF08153.18`	NGP1NT	46	171	2.9e-47	160.8
LXL04_016490	`PF02421.25`	FeoB_N	311	374	1.3e-06	28.8
LXL04_016490	`PF01926.30`	MMR_HSR1	312	377	5e-20	72.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C923`	Arabidopsis thaliana	Nuclear/nucleolar GTPase 2	76.550%	Swiss-Prot	strong database homology
`Q10LF7`	Oryza sativa subsp. japonica	Nuclear/nucleolar GTPase 2	74.905%	Swiss-Prot	strong database homology
`A2XGQ1`	Oryza sativa subsp. indica	Nuclear/nucleolar GTPase 2	74.905%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card