LXL04_016020 | RubberDandelionOmics

Gene overview

LXL04_016020

Reference: OH-1004 Chr: Chr03 Coordinates: 104006790-104011516 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2553 bp · LXL04_016020|LXL04_016020|OH1004|cDNA

ATGAGGAGAAACCAAAACAAGGCTAACAATGATAAACACGACAACAGCAATGGCTTAATTCCTAATTCATTCAGATTCATTTCTTCATATATCAAGACCGTCTCTTCGAACGTCAGGTCCGCTGGAGCCTCCGTTTCTGGATCGGTTTCCGTTGATTCCTCCGATGAACTTCGAAAAGACCAGGTACTATGGTCTTGCTTTGATAGATTAGAGCTCAATCCATCAACCATCAAGAACGTCCTTCTACTTGGTTACTCAAA...

CDS

Download CDS FASTA

2553 bp · LXL04_016020|LXL04_016020|OH1004|CDS

ATGAGGAGAAACCAAAACAAGGCTAACAATGATAAACACGACAACAGCAATGGCTTAATTCCTAATTCATTCAGATTCATTTCTTCATATATCAAGACCGTCTCTTCGAACGTCAGGTCCGCTGGAGCCTCCGTTTCTGGATCGGTTTCCGTTGATTCCTCCGATGAACTTCGAAAAGACCAGGTACTATGGTCTTGCTTTGATAGATTAGAGCTCAATCCATCAACCATCAAGAACGTCCTTCTACTTGGTTACTCAAA...

Protein

Download Protein FASTA

850 aa · LXL04_016020|LXL04_016020|OH1004|PROTEIN

MRRNQNKANNDKHDNSNGLIPNSFRFISSYIKTVSSNVRSAGASVSGSVSVDSSDELRKDQVLWSCFDRLELNPSTIKNVLLLGYSNGFQVLDVDDGSNFTELVSTRDDPVTFLQIQPTPEEKPTDEGHEKEGYKMSHPLLLVVASEETRVQGTSQTEREREREKDEESSMYSPRTVRFYSLKSHSYVHVLRFRSTVYMVRCSPRIVAVGLASQIYCFDAVTLENKFSVLTYPISQLGGQGLSGVNIGYGPMAVGPRWLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016020`
TK1151 ID	TkA02G282780
OH-1004 ID	LXL04_016020
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.100
Protein coverage (%)	TK1151 100.000 / OH-1004 48.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016020

Location Chr03:104006790-104011516 (-)

Description Similar to ATG18H: Autophagy-related protein 18h

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54710`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	No verified direct reference in this release
`At1g03380`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	No verified direct reference in this release
`At5g54730`	The PI(3,5)P2 regulatory complex regulates both the synthesis and turnover of phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016020 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006914 autophagy Biological Process

GO:0007267 cell-cell signaling Biological Process

GO:0010595 positive regulation of endothelial cell migration Biological Process

GO:0015031 protein transport Biological Process

GO:0032956 regulation of actin cytoskeleton organization Biological Process

GO:0042594 response to starvation Biological Process

GO:0043085 positive regulation of catalytic activity Biological Process

GO:0043627 response to estrogen Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0071391 cellular response to estrogen stimulus Biological Process

GO:0000407 phagophore assembly site Cellular Component

KEGG gene cross-reference

ath:AT1G03380

ath:AT1G54710

ath:AT5G54730

hsa:54828

mmu:192197

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.488

Rank 1 · LXL04_016020 · OH-1004

Nucleus0.252

Rank 2 · LXL04_016020 · OH-1004

Golgi apparatus0.196

Rank 3 · LXL04_016020 · OH-1004

Lysosome / Vacuole0.164

Rank 4 · LXL04_016020 · OH-1004

Cell membrane0.113

Rank 5 · LXL04_016020 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21034.4BCAS3_WD4052-477 aa

PF00400.39WD40368-396 aa

PF12490.14BCAS3593-625 aa

PF12490.14BCAS3635-703 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016020	`PF21034.4`	BCAS3_WD40	52	477	1.5e-59	202.5
LXL04_016020	`PF00400.39`	WD40	368	396	1.6e-08	35.5
LXL04_016020	`PF12490.14`	BCAS3	593	625	2e-33	116.3
LXL04_016020	`PF12490.14`	BCAS3	635	703	2e-33	116.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1Q5`	Arabidopsis thaliana	Autophagy-related protein 18h	57.810%	Swiss-Prot	strong database homology
`Q8GUL1`	Arabidopsis thaliana	Autophagy-related protein 18g	47.072%	Swiss-Prot	moderate database homology
`Q9FH32`	Arabidopsis thaliana	Autophagy-related protein 18f	35.128%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card