LXL04_015311 | RubberDandelionOmics

Gene overview

LXL04_015311

Reference: OH-1004 Chr: Chr03 Coordinates: 68317570-68320069 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2001 bp · LXL04_015311|LXL04_015311|OH1004|cDNA

ATGCAAACCACTGgatcaagaacaacaactcaaAGAAGAAGACCAATCTCTCTAATGGGTAGAAAAATCAAAGCCAAACAAAAACAGCAATCGGTGAACAAAACAGGTAATCAAGTAGAATCCATTACCCAGGAAACAAAGATGATCAATACTTCAAGTCTCAGTAACAAATATCAGCCAAGACTCTTCCAAGAGATTGTGGGGCATAGTATTGTAATCAAAACCCTTTCTAACGCCATCCAGAAGAAAAAAATCGCGCC...

CDS

Download CDS FASTA

2001 bp · LXL04_015311|LXL04_015311|OH1004|CDS

ATGCAAACCACTGGATCAAGAACAACAACTCAAAGAAGAAGACCAATCTCTCTAATGGGTAGAAAAATCAAAGCCAAACAAAAACAGCAATCGGTGAACAAAACAGGTAATCAAGTAGAATCCATTACCCAGGAAACAAAGATGATCAATACTTCAAGTCTCAGTAACAAATATCAGCCAAGACTCTTCCAAGAGATTGTGGGGCATAGTATTGTAATCAAAACCCTTTCTAACGCCATCCAGAAGAAAAAAATCGCGCC...

Protein

Download Protein FASTA

666 aa · LXL04_015311|LXL04_015311|OH1004|PROTEIN

MQTTGSRTTTQRRRPISLMGRKIKAKQKQQSVNKTGNQVESITQETKMINTSSLSNKYQPRLFQEIVGHSIVIKTLSNAIQKKKIAPLYLFHGPTGTGKTSTARVFAMALNCESTFHNTKPCCSCKGCSRSLYTMDLCSANGFGKIKTILHNTSFAQAIPGMKVFIIEECQLLTMDTWDELMRLVEGPYASNLVFLLITTDANSIAGNISSRCHKFCFKKLKDEDVAEKISRILVHERLGIETEALKLIVAKSEGSLRDA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015311`
TK1151 ID	TkA02G347360
OH-1004 ID	LXL04_015311
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.200
Protein coverage (%)	TK1151 100.000 / OH-1004 91.742 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015311

Location Chr03:68317570-68320069 (+)

Description Similar to At5g45720: Protein STICHEL-like 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g45720`	Protein STICHEL-like 4.	No verified direct reference in this release
`At4g18820`	Protein STICHEL-like 3.	No verified direct reference in this release
`At1g14460`	Protein STICHEL-like 1.	No verified direct reference in this release
`At2g02480`	Acts as a key regulator of trichome branching through an endoreduplication-independent pathway.	No verified direct reference in this release
`At4g24790`	Protein STICHEL-like 2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015311 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0010026 trichome differentiation Biological Process

GO:0010091 trichome branching Biological Process

GO:0005634 nucleus Cellular Component

GO:0005663 DNA replication factor C complex Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009360 DNA polymerase III complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G14460

ath:AT2G02480

ath:AT4G18820

ath:AT4G24790

ath:AT5G45720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.698

Rank 1 · LXL04_015311 · OH-1004

Cytoplasm0.214

Rank 2 · LXL04_015311 · OH-1004

Cell membrane0.059

Rank 3 · LXL04_015311 · OH-1004

Plastid0.046

Rank 4 · LXL04_015311 · OH-1004

Endoplasmic reticulum0.031

Rank 5 · LXL04_015311 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13177.13DNA_pol3_delta269-221 aa

PF00004.36AAA89-218 aa

PF22608.3DNAX_ATPase_lid226-266 aa

PF23007.2DnaA_N-like_STI435-513 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015311	`PF13177.13`	DNA_pol3_delta2	69	221	6.3e-21	75.8
LXL04_015311	`PF00004.36`	AAA	89	218	1.7e-06	29.2
LXL04_015311	`PF22608.3`	DNAX_ATPase_lid	226	266	2.8e-07	30.9
LXL04_015311	`PF23007.2`	DnaA_N-like_STI	435	513	1.2e-16	61.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KEM0`	Arabidopsis thaliana	Protein STICHEL-like 4	35.908%	Swiss-Prot	moderate database homology
`F4JRP0`	Arabidopsis thaliana	Protein STICHEL-like 3	34.362%	Swiss-Prot	moderate database homology
`F4HW65`	Arabidopsis thaliana	Protein STICHEL-like 1	40.576%	Swiss-Prot	moderate database homology
`O64728`	Arabidopsis thaliana	Protein STICHEL	39.250%	Swiss-Prot	moderate database homology
`F4JRP8`	Arabidopsis thaliana	Protein STICHEL-like 2	32.465%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card