LXL04_014290 | RubberDandelionOmics

Gene overview

LXL04_014290

Reference: OH-1004 Chr: Chr03 Coordinates: 45546841-45547884 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

465 bp · LXL04_014290|LXL04_014290|OH1004|cDNA

ATGCAGATATTCGTCAAAACCCTAACTGGGAAAACCATCACTCTCGAGGTTGAGAGCAGCGACACCATCGACAATGTCAAAGCCAAGATCCAGGACAAAGAGGGAATCCCTCCAGATCAACAGAGATTGATTTTTGCTGGAAAGCAATTAGAAGATGGAAGAACGCTTGCTGATTACAACATCCAGAAAGAGTCAACACTTCATCTTGTTCTAAGATTGAGAGGAGGAACCATGATCAAGGTCAAAACTCTTACAGGAAA...

CDS

Download CDS FASTA

465 bp · LXL04_014290|LXL04_014290|OH1004|CDS

ATGCAGATATTCGTCAAAACCCTAACTGGGAAAACCATCACTCTCGAGGTTGAGAGCAGCGACACCATCGACAATGTCAAAGCCAAGATCCAGGACAAAGAGGGAATCCCTCCAGATCAACAGAGATTGATTTTTGCTGGAAAGCAATTAGAAGATGGAAGAACGCTTGCTGATTACAACATCCAGAAAGAGTCAACACTTCATCTTGTTCTAAGATTGAGAGGAGGAACCATGATCAAGGTCAAAACTCTTACAGGAAA...

Protein

Download Protein FASTA

154 aa · LXL04_014290|LXL04_014290|OH1004|PROTEIN

MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGTMIKVKTLTGKEIEIDIEPTDTIDRIKERVEEKEGIPPVQQRLIYAGKQLADDKTAKDYNIEGGSVLHLVLALRGGNL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014290`
TK1151 ID	TkA02G441270
OH-1004 ID	LXL04_014290
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014290

Location Chr03:45546841-45547884 (+)

Description Similar to RUB2: Ubiquitin-NEDD8-like protein RUB2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31340`	Ubiquitin exists either covalently attached to another protein, or free (unanchored).	The Arabidopsis cullin AtCUL1 is modified by the ubiquitin-related protein RUB1.1999 · DOI: 10.1073/pnas.96.26.15342 The ubiquitin-related protein RUB1 and auxin response in Arabidopsis.1998 · DOI: 10.1126/science.280.5370.1760
`At2g35635`	Ubiquitin exists either covalently attached to another protein, or free (unanchored).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0650100`	Ubiquitin exists either covalently attached to another protein, or free (unanchored).	No verified direct reference in this release
`Os09g0420800`	Ubiquitin exists either covalently attached to another protein, or free (unanchored).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014290 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009693 ethylene biosynthetic process Biological Process

GO:0009733 response to auxin Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0019941 modification-dependent protein catabolic process Biological Process

GO:0045116 protein neddylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0003735 structural constituent of ribosome Molecular Function

GO:0031386 protein tag activity Molecular Function

KEGG gene cross-reference

ath:AT1G31340

dosa:Os09g0420800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.698

Rank 1 · LXL04_014290 · OH-1004

Nucleus0.331

Rank 2 · LXL04_014290 · OH-1004

Cell membrane0.123

Rank 3 · LXL04_014290 · OH-1004

Extracellular0.119

Rank 4 · LXL04_014290 · OH-1004

Mitochondrion0.118

Rank 5 · LXL04_014290 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11976.15Rad60-SLD1-71 aa

PF00240.30ubiquitin3-74 aa

PF14560.13Ubiquitin_211-69 aa

PF00240.30ubiquitin79-149 aa

PF11976.15Rad60-SLD79-147 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014290	`PF11976.15`	Rad60-SLD	1	71	8.3e-35	119.1
LXL04_014290	`PF00240.30`	ubiquitin	3	74	1.5e-62	208.0
LXL04_014290	`PF14560.13`	Ubiquitin_2	11	69	4e-11	43.9
LXL04_014290	`PF00240.30`	ubiquitin	79	149	1.5e-62	208.0
LXL04_014290	`PF11976.15`	Rad60-SLD	79	147	8.3e-35	119.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHE7`	Arabidopsis thaliana	Ubiquitin-NEDD8-like protein RUB1	100.000%	Swiss-Prot	strong database homology
`Q8RUC6`	Arabidopsis thaliana	Ubiquitin-NEDD8-like protein RUB2	98.701%	Swiss-Prot	strong database homology
`P0C031`	Oryza sativa subsp. japonica	Ubiquitin-NEDD8-like protein RUB2	99.346%	Swiss-Prot	strong database homology
`P0C030`	Oryza sativa subsp. japonica	Ubiquitin-NEDD8-like protein RUB1	100.000%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card