LXL04_014035 | RubberDandelionOmics

Gene overview

LXL04_014035

Reference: OH-1004 Chr: Chr03 Coordinates: 40988915-40992389 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1932 bp · LXL04_014035|LXL04_014035|OH1004|cDNA

ATGAAATTTGAAAGGAGGCTGCCTGGCGATGACGTCATGGTCGGGATCGGGATCGGCGTCGGCGTCGTCGTCGTCGGATTCGAGTTTGGGGGATATAAATTCACCAATAAGAAAACGGTTGCACCTCCAGGATTAGTGAAGACACCACATGGGGTGAAACATCAAATTGAGTTAACCTTGGAGCAAATCTTTGGTCCACCAGACGTGAACTTCAAATTGCAAATCGCAATAACACTTCTGCTGATGATGAAGACCATCTT...

CDS

Download CDS FASTA

1932 bp · LXL04_014035|LXL04_014035|OH1004|CDS

ATGAAATTTGAAAGGAGGCTGCCTGGCGATGACGTCATGGTCGGGATCGGGATCGGCGTCGGCGTCGTCGTCGTCGGATTCGAGTTTGGGGGATATAAATTCACCAATAAGAAAACGGTTGCACCTCCAGGATTAGTGAAGACACCACATGGGGTGAAACATCAAATTGAGTTAACCTTGGAGCAAATCTTTGGTCCACCAGACGTGAACTTCAAATTGCAAATCGCAATAACACTTCTGCTGATGATGAAGACCATCTT...

Protein

Download Protein FASTA

643 aa · LXL04_014035|LXL04_014035|OH1004|PROTEIN

MKFERRLPGDDVMVGIGIGVGVVVVGFEFGGYKFTNKKTVAPPGLVKTPHGVKHQIELTLEQIFGPPDVNFKLQIAITLLLMMKTILRRIIIPYAKLSPVINNNLPRFHNHINTAAESPHSAAAQEEEDKTAESITCICKSFSNNLNWEILNQKFMFVDLRNSATINRVLIQLKEPLDAKKALSFFHWSAHLANIKHPTNTYALLIHILVNAKLIRDASALIESVLVRSVKGNFNNPSGSANLLKNYQFHNLNCDGSSSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014035`
TK1151 ID	TkAUNG097110
OH-1004 ID	LXL04_014035
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	96.800
Protein coverage (%)	TK1151 100.000 / OH-1004 87.247 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014035

Location Chr03:40988915-40992389 (-)

Description Similar to At1g66345: Pentatricopeptide repeat-containing protein At1g66345, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g66345`	Pentatricopeptide repeat-containing protein At1g66345, mitochondrial.	No verified direct reference in this release
`At5g39710`	Pentatricopeptide repeat-containing protein At5g39710.	No verified direct reference in this release
`At2g02150`	Putative pentatricopeptide repeat-containing protein At2g02150.	No verified direct reference in this release
`At5g01110`	Pentatricopeptide repeat-containing protein At5g01110.	No verified direct reference in this release
`At5g61990`	Pentatricopeptide repeat-containing protein At5g61990, mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014035 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0000963 mitochondrial RNA processing Biological Process

GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process

GO:0090615 mitochondrial mRNA processing Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0036002 pre-mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G66345

ath:AT2G02150

ath:AT5G39710

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.797

Rank 1 · LXL04_014035 · OH-1004

Plastid0.112

Rank 2 · LXL04_014035 · OH-1004

Nucleus0.062

Rank 3 · LXL04_014035 · OH-1004

Cytoplasm0.036

Rank 4 · LXL04_014035 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_014035 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17177.11PPR_long282-405 aa

PF13041.13PPR_2314-360 aa

PF13041.13PPR_2429-461 aa

PF01535.27PPR456-483 aa

PF13812.13PPR_3551-600 aa

PF12854.14PPR_1552-584 aa

PF13041.13PPR_2556-600 aa

PF01535.27PPR560-587 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014035	`PF17177.11`	PPR_long	282	405	3.3e-11	43.7
LXL04_014035	`PF13041.13`	PPR_2	314	360	6e-35	119.8
LXL04_014035	`PF13041.13`	PPR_2	429	461	6e-35	119.8
LXL04_014035	`PF01535.27`	PPR	456	483	3.7e-29	99.6
LXL04_014035	`PF13812.13`	PPR_3	551	600	2.3e-17	63.6
LXL04_014035	`PF12854.14`	PPR_1	552	584	3.8e-17	62.4
LXL04_014035	`PF13041.13`	PPR_2	556	600	6e-35	119.8
LXL04_014035	`PF01535.27`	PPR	560	587	3.7e-29	99.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3ECH5`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g66345, mitochondrial	46.640%	Swiss-Prot	moderate database homology
`Q9FIX3`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g39710	23.899%	Swiss-Prot	weak database homology
`P0C894`	Arabidopsis thaliana	Putative pentatricopeptide repeat-containing protein At2g02150	23.195%	Swiss-Prot	weak database homology
`Q9LFC5`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g01110	24.169%	Swiss-Prot	weak database homology
`Q9FIT7`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g61990, mitochondrial	22.535%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card