LXL04_013731 | RubberDandelionOmics

Gene overview

LXL04_013731

Reference: OH-1004 Chr: Chr03 Coordinates: 34920091-34921326 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · LXL04_013731|LXL04_013731|OH1004|cDNA

ATGTCGTCTTCGTCTTCCGCCATCCTCCGCCGCGCCCGCCATCTATCCACCGCCGTCGCTACTGCGGCCACCACCGATGTCACAAGCTCAGCTTCCATGACCATTTCCAAAGCCAAATCGAAACTCAAAACGGAACACGATACCGACAAAGCTCTAAACATTTACTCAACCGTCAAAGCCAATTACTCCGCATCGTCACCCGGATCCGCTAATCATGCTCAGCAGATCACAGTCCGCCGCCTTGCAAAATCTCATCGTTT...

CDS

Download CDS FASTA

1236 bp · LXL04_013731|LXL04_013731|OH1004|CDS

ATGTCGTCTTCGTCTTCCGCCATCCTCCGCCGCGCCCGCCATCTATCCACCGCCGTCGCTACTGCGGCCACCACCGATGTCACAAGCTCAGCTTCCATGACCATTTCCAAAGCCAAATCGAAACTCAAAACGGAACACGATACCGACAAAGCTCTAAACATTTACTCAACCGTCAAAGCCAATTACTCCGCATCGTCACCCGGATCCGCTAATCATGCTCAGCAGATCACAGTCCGCCGCCTTGCAAAATCTCATCGTTT...

Protein

Download Protein FASTA

411 aa · LXL04_013731|LXL04_013731|OH1004|PROTEIN

MSSSSSAILRRARHLSTAVATAATTDVTSSASMTISKAKSKLKTEHDTDKALNIYSTVKANYSASSPGSANHAQQITVRRLAKSHRFSDIEALLESHKSDPRITDEHFLSSLIKSYGIAGMFEQALNTYNQMETLKTPRSALSFNALLTACLKSKNYDRAPQLFDEMPAKYRFRPDEYSYGMLVKSFCDAGKPELAIDKLKEMDKKGMPISGITYTSIIHSLYKKGNPTEAEKIWDEMVNRGCLIDVAANNVRLMNAVDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013731`
TK1151 ID	TkA02G474840
OH-1004 ID	LXL04_013731
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.098 / OH-1004 89.538 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013731

Location Chr03:34920091-34921326 (+)

Description Similar to At4g36680: Pentatricopeptide repeat-containing protein At4g36680, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g36680`	Small ribosomal subunit protein mL103 (rPPR7).	No verified direct reference in this release
`At2g18520`	Pentatricopeptide repeat-containing protein At2g18520, mitochondrial.	No verified direct reference in this release
`At3g13160`	Small ribosomal subunit protein mS79 (rPPR3b).	No verified direct reference in this release
`At1g61870`	May be involved in translation through its association with polysomes.	No verified direct reference in this release
`At1g55890`	Small ribosomal subunit protein mS78 (rPPR3a).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013731 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006396 RNA processing Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005840 ribosome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G55890

ath:AT1G61870

ath:AT2G18520

ath:AT3G13160

ath:AT4G36680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.887

Rank 1 · LXL04_013731 · OH-1004

Plastid0.067

Rank 2 · LXL04_013731 · OH-1004

Nucleus0.051

Rank 3 · LXL04_013731 · OH-1004

Cytoplasm0.034

Rank 4 · LXL04_013731 · OH-1004

Cell membrane0.013

Rank 5 · LXL04_013731 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070.1MSC6_N80-197 aa

PF17177.11PPR_long124-227 aa

PF13041.13PPR_2141-189 aa

PF23276.3TPR_24172-253 aa

PF12854.14PPR_1174-203 aa

PF13041.13PPR_2175-224 aa

PF29070.1MSC6_N198-306 aa

PF13812.13PPR_3200-243 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013731	`PF29070.1`	MSC6_N	80	197	8e-17	62.1
LXL04_013731	`PF17177.11`	PPR_long	124	227	3.9e-14	53.2
LXL04_013731	`PF13041.13`	PPR_2	141	189	4.5e-42	142.6
LXL04_013731	`PF23276.3`	TPR_24	172	253	2.5e-17	63.7
LXL04_013731	`PF12854.14`	PPR_1	174	203	3.3e-35	120.2
LXL04_013731	`PF13041.13`	PPR_2	175	224	4.5e-42	142.6
LXL04_013731	`PF29070.1`	MSC6_N	198	306	8e-17	62.1
LXL04_013731	`PF13812.13`	PPR_3	200	243	2.8e-21	76.1
LXL04_013731	`PF12854.14`	PPR_1	207	239	3.3e-35	120.2
LXL04_013731	`PF13041.13`	PPR_2	213	247	4.5e-42	142.6
LXL04_013731	`PF01535.27`	PPR	213	243	7.8e-38	126.8
LXL04_013731	`PF17177.11`	PPR_long	253	342	3.9e-14	53.2
LXL04_013731	`PF23276.3`	TPR_24	257	370	2.5e-17	63.7
LXL04_013731	`PF13812.13`	PPR_3	268	323	2.8e-21	76.1
LXL04_013731	`PF12854.14`	PPR_1	277	306	3.3e-35	120.2
LXL04_013731	`PF13041.13`	PPR_2	279	328	4.5e-42	142.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M065`	Arabidopsis thaliana	Small ribosomal subunit protein mL103 (rPPR7)	56.448%	Swiss-Prot	strong database homology
`Q9ZU67`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g18520, mitochondrial	54.386%	Swiss-Prot	strong database homology
`Q9LK57`	Arabidopsis thaliana	Small ribosomal subunit protein mS79 (rPPR3b)	30.133%	Swiss-Prot	moderate database homology
`Q8LE47`	Arabidopsis thaliana	Small ribosomal subunit protein mS86 (rPPR1)	30.303%	Swiss-Prot	moderate database homology
`Q9LG23`	Arabidopsis thaliana	Small ribosomal subunit protein mS78 (rPPR3a)	33.333%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card