LXL04_013670 | RubberDandelionOmics

Gene overview

LXL04_013670

Reference: OH-1004 Chr: Chr03 Coordinates: 33980013-33984493 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2427 bp · LXL04_013670|LXL04_013670|OH1004|cDNA

ATGAAGATCAATGAACTAAGTGAGAAGATACCTCCGGAGATTTTAAAGATGACCTCACTTAGTCAACTCAAGAAGTTCAAAGCTTTGACTAAGATAAGAAGTGACCCCATACATGTGCAAAACTTTTGGCAAATTGAAGAAGGCGATCGAGAGATTTGGGTCAAATACATTTTGGAAGGgAAAATGAGGAGAAAGATCACGTTCGTCGGGAGTATCGGAGCAACCCTTGTTATCGTGGTTGTTACGATGGCTATCGTCAT...

CDS

Download CDS FASTA

2427 bp · LXL04_013670|LXL04_013670|OH1004|CDS

ATGAAGATCAATGAACTAAGTGAGAAGATACCTCCGGAGATTTTAAAGATGACCTCACTTAGTCAACTCAAGAAGTTCAAAGCTTTGACTAAGATAAGAAGTGACCCCATACATGTGCAAAACTTTTGGCAAATTGAAGAAGGCGATCGAGAGATTTGGGTCAAATACATTTTGGAAGGGAAAATGAGGAGAAAGATCACGTTCGTCGGGAGTATCGGAGCAACCCTTGTTATCGTGGTTGTTACGATGGCTATCGTCAT...

Protein

Download Protein FASTA

808 aa · LXL04_013670|LXL04_013670|OH1004|PROTEIN

MKINELSEKIPPEILKMTSLSQLKKFKALTKIRSDPIHVQNFWQIEEGDREIWVKYILEGKMRRKITFVGSIGATLVIVVVTMAIVISLARSFHRPLCTSSTTKHLLKSRICPLWSPSFFLCLPTTPRTTLLRHSPAAAPRRASFCSATLPSSMTTVADENPLLKDFEFPPFDVIDASHVRPGMRALLNKLDSDLAELEKNVEPSWPKLVEPLEKMMDRLSVVWGAINHLKAVKDTPELRSAIEEIQAIRESPDWAKLSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013670`
TK1151 ID	TkA02G479730
OH-1004 ID	LXL04_013670
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.600
Protein coverage (%)	TK1151 100.000 / OH-1004 92.450 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013670

Location Chr03:33980013-33984493 (-)

Description Similar to OOP: Organellar oligopeptidase A, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65620`	Oligopeptidase degrading short peptides from 8 to 23 amino acid residues.	Organellar oligopeptidase (OOP) provides a complementary pathway for targeting peptide degradation in mitochondria and chloroplasts.2013 · DOI: 10.1073/pnas.1307637110
`At5g10540`	Oligopeptidase that may be involved in the degradation of proteasome-generated peptides (By similarity).	Organellar oligopeptidase (OOP) provides a complementary pathway for targeting peptide degradation in mitochondria and chloroplasts.2013 · DOI: 10.1073/pnas.1307637110

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013670 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0006465 signal peptide processing Biological Process

GO:0006508 proteolysis Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0048046 apoplast Cellular Component

KEGG gene cross-reference

ath:AT5G10540

ath:AT5G65620

ecj:JW3465

eco:b3498

ecoc:C3026_18945

hin:HI_0214

stm:STM3594

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.458

Rank 1 · LXL04_013670 · OH-1004

Mitochondrion0.410

Rank 2 · LXL04_013670 · OH-1004

Cytoplasm0.158

Rank 3 · LXL04_013670 · OH-1004

Peroxisome0.116

Rank 4 · LXL04_013670 · OH-1004

Nucleus0.057

Rank 5 · LXL04_013670 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19310.5TOP_N184-248 aa

PF19310.5TOP_N247-292 aa

PF01432.27Peptidase_M3372-725 aa

PF01432.27Peptidase_M3736-802 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013670	`PF19310.5`	TOP_N	184	248	1e-31	110.0
LXL04_013670	`PF19310.5`	TOP_N	247	292	1e-31	110.0
LXL04_013670	`PF01432.27`	Peptidase_M3	372	725	1.2e-116	391.6
LXL04_013670	`PF01432.27`	Peptidase_M3	736	802	1.2e-116	391.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AM1`	Arabidopsis thaliana	Organellar oligopeptidase A, chloroplastic/mitochondrial	68.507%	Swiss-Prot	strong database homology
`Q949P2`	Arabidopsis thaliana	Probable cytosolic oligopeptidase A	72.961%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card