LXL04_012179 | RubberDandelionOmics

Gene overview

LXL04_012179

Reference: OH-1004 Chr: Chr03 Coordinates: 7890208-7892112 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1074 bp · LXL04_012179|LXL04_012179|OH1004|cDNA

ATGGGGAAATCAAAGGGGTCAAGGAAAGGGAAGAAAGCATGGAGAGCGAATATTAGCACAGAAGACATTGAGGATTTCTATGAGAAATCTAGCAAAGACGCTCTTTCCGGCGGTTCTCTTACCGAAGTCCCTAGTGATTCCCTGTTCTTCGTCGACAAGTCCAGAGATCTTTCTGTCAAGCGTAAAATCGATAAACACAGAGAGAAGATACTTCGTGTTGATAGCATCCTCCAGAAAAACTCCTTTGTACAGGCTGTACC...

CDS

Download CDS FASTA

1074 bp · LXL04_012179|LXL04_012179|OH1004|CDS

ATGGGGAAATCAAAGGGGTCAAGGAAAGGGAAGAAAGCATGGAGAGCGAATATTAGCACAGAAGACATTGAGGATTTCTATGAGAAATCTAGCAAAGACGCTCTTTCCGGCGGTTCTCTTACCGAAGTCCCTAGTGATTCCCTGTTCTTCGTCGACAAGTCCAGAGATCTTTCTGTCAAGCGTAAAATCGATAAACACAGAGAGAAGATACTTCGTGTTGATAGCATCCTCCAGAAAAACTCCTTTGTACAGGCTGTACC...

Protein

Download Protein FASTA

357 aa · LXL04_012179|LXL04_012179|OH1004|PROTEIN

MGKSKGSRKGKKAWRANISTEDIEDFYEKSSKDALSGGSLTEVPSDSLFFVDKSRDLSVKRKIDKHREKILRVDSILQKNSFVQAVPSSNQKNSFKKRKASAENSSQKNGTTDTGMVDIWDNKGEQAGKARKVSKLMVIPAVEVEPPGCSYNPTSESHQDSLAHAVADEMQKIYTKELRPTPVPLTVPGEAIDDEDMYFLDADKENDDDDDDDDVDENDDADLEKRPFKTKRVTRVVLNKRIRNKEKMKVQAEAKKTKEF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012179`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012179

Location Chr03:7890208-7892112 (+)

Description Similar to At2g40430: Ribosome biogenesis protein NOP53

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g40430`	May play a role in ribosome biogenesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012179 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000027 ribosomal large subunit assembly Biological Process

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000460 maturation of 5.8S rRNA Biological Process

GO:0001932 regulation of protein phosphorylation Biological Process

GO:0006281 DNA repair Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process

GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0031333 negative regulation of protein-containing complex assembly Biological Process

GO:0032435 negative regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

KEGG gene cross-reference

ath:AT2G40430

cel:CELE_Y39B6A.33

mmu:68077

spo:2541680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.968

Rank 1 · LXL04_012179 · OH-1004

Cytoplasm0.100

Rank 2 · LXL04_012179 · OH-1004

Mitochondrion0.014

Rank 3 · LXL04_012179 · OH-1004

Cell membrane0.010

Rank 4 · LXL04_012179 · OH-1004

Extracellular0.006

Rank 5 · LXL04_012179 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07767.17Nop537-342 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012179	`PF07767.17`	Nop53	7	342	2.2e-62	212.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22892`	Arabidopsis thaliana	Ribosome biogenesis protein NOP53	55.462%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card