LXL04_011839 | RubberDandelionOmics

Gene overview

LXL04_011839

Reference: OH-1004 Chr: Chr03 Coordinates: 1299019-1302650 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2373 bp · LXL04_011839|LXL04_011839|OH1004|cDNA

ATGTCTGCTCTTCAAGCTTTTCTCATCTGTAAACCCCCAACAGTCTCTAATCTAGTGCCTCACTCAAGACGTCTTCAATTTCATCGTATTCACTCTTTTAATTTGGGTTCTTTTCCTTCAACAAGTTATCGCAATAAATCTCGCCCTTTCTTCGCATTGCATCAAGATAATGTCGATTCGAATTCGGGTCTAGCTTCATCGAGTAATGGTAATCACAATCTAGCACGGGAGTCGGAGACCCAAGTTGTCGACTTTACCGA...

CDS

Download CDS FASTA

2373 bp · LXL04_011839|LXL04_011839|OH1004|CDS

ATGTCTGCTCTTCAAGCTTTTCTCATCTGTAAACCCCCAACAGTCTCTAATCTAGTGCCTCACTCAAGACGTCTTCAATTTCATCGTATTCACTCTTTTAATTTGGGTTCTTTTCCTTCAACAAGTTATCGCAATAAATCTCGCCCTTTCTTCGCATTGCATCAAGATAATGTCGATTCGAATTCGGGTCTAGCTTCATCGAGTAATGGTAATCACAATCTAGCACGGGAGTCGGAGACCCAAGTTGTCGACTTTACCGA...

Protein

Download Protein FASTA

790 aa · LXL04_011839|LXL04_011839|OH1004|PROTEIN

MSALQAFLICKPPTVSNLVPHSRRLQFHRIHSFNLGSFPSTSYRNKSRPFFALHQDNVDSNSGLASSSNGNHNLARESETQVVDFTEGEVSNSEECLNEAEGEINGAGDEVGKEKGKLPLFVFLMGFFARMKSGFEKMLLSDGFSWWPFWRQEKKLELLISEADLNPKDAAKQSALLVELNKHSPESVIRRFEQRQYAVDSKGVAEYIRALVATNAISEYLPDEQSGKPSSLPALLQELKQRASGNLDESFLNPGISERQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011839`
TK1151 ID	TkA02G609420
OH-1004 ID	LXL04_011839
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011839

Location Chr03:1299019-1302650 (-)

Description Similar to FTSH11: ATP-dependent zinc metalloprotease FTSH 11, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53170`	Probable ATP-dependent zinc metallopeptidase.	FtsH11 protease plays a critical role in Arabidopsis thermotolerance.2006 · DOI: 10.1111/j.1365-313x.2006.02855.x
`At2g26140`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0618800`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release
`Os01g0574500`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release
`Os01g0574400`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011839 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009408 response to heat Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010304 PSII associated light-harvesting complex II catabolic process Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT2G26140

ath:AT5G53170

dosa:Os01g0574400

dosa:Os01g0574500

dosa:Os01g0618800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.917

Rank 1 · LXL04_011839 · OH-1004

Mitochondrion0.086

Rank 2 · LXL04_011839 · OH-1004

Cytoplasm0.032

Rank 3 · LXL04_011839 · OH-1004

Nucleus0.030

Rank 4 · LXL04_011839 · OH-1004

Cell membrane0.019

Rank 5 · LXL04_011839 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00004.36AAA379-507 aa

PF17862.8AAA_lid_3530-572 aa

PF01434.25Peptidase_M41589-764 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011839	`PF00004.36`	AAA	379	507	4.5e-42	144.3
LXL04_011839	`PF17862.8`	AAA_lid_3	530	572	1.6e-09	37.9
LXL04_011839	`PF01434.25`	Peptidase_M41	589	764	1e-60	205.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGM0`	Arabidopsis thaliana	ATP-dependent zinc metalloprotease FTSH 11, chloroplastic/mitochondrial	75.589%	Swiss-Prot	strong database homology
`O80983`	Arabidopsis thaliana	ATP-dependent zinc metalloprotease FTSH 4, mitochondrial	52.483%	Swiss-Prot	strong database homology
`A2ZVG7`	Oryza sativa subsp. japonica	ATP-dependent zinc metalloprotease FTSH 9, chloroplastic/mitochondrial	79.851%	Swiss-Prot	strong database homology
`Q8LQJ8`	Oryza sativa subsp. japonica	ATP-dependent zinc metalloprotease FTSH 5, mitochondrial	51.923%	Swiss-Prot	strong database homology
`Q8LQJ9`	Oryza sativa subsp. japonica	ATP-dependent zinc metalloprotease FTSH 4, mitochondrial	49.373%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card