LXL04_011397 | RubberDandelionOmics

Gene overview

LXL04_011397

Reference: OH-1004 Chr: Chr02 Coordinates: 163782334-163785352 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1849 bp · LXL04_011397|LXL04_011397|OH1004|cDNA

ATGGAGAGTAGTTGCAGCACTAACGATGTCGGAGAGTGGAAGGCAGAGGAAGCCATAGCTGGTAATGCTGAAGCTCTTCAAGCTCTTCGAGAACTCATAACATATCCTCTGCTCTACTCTAAAGAAGCCAGACAGCTTGGCCTTAAGTGGCCTCGCGGTTTGCTGCTTTACGGTCCTCCTGGCACTGGAAAGACTAGCTTGGTTCGAGCAGTTGTTCATGAATGTGATGCACATTTGATAGTTCTCAGTCCACACTCTGT...

CDS

Download CDS FASTA

1848 bp · LXL04_011397|LXL04_011397|OH1004|CDS

ATGGAGAGTAGTTGCAGCACTAACGATGTCGGAGAGTGGAAGGCAGAGGAAGCCATAGCTGGTAATGCTGAAGCTCTTCAAGCTCTTCGAGAACTCATAACATATCCTCTGCTCTACTCTAAAGAAGCCAGACAGCTTGGCCTTAAGTGGCCTCGCGGTTTGCTGCTTTACGGTCCTCCTGGCACTGGAAAGACTAGCTTGGTTCGAGCAGTTGTTCATGAATGTGATGCACATTTGATAGTTCTCAGTCCACACTCTGT...

Protein

Download Protein FASTA

615 aa · LXL04_011397|LXL04_011397|OH1004|PROTEIN

MESSCSTNDVGEWKAEEAIAGNAEALQALRELITYPLLYSKEARQLGLKWPRGLLLYGPPGTGKTSLVRAVVHECDAHLIVLSPHSVHRSHAGESEKILRDAFAEASSHIKLGKPSVIFIDEIDAICPRRDSRRQQDIRIASQLIMLMDSSATSASGTKVVVVASTNRVDALDPALRRSGRFDAEIEVTTPSEQERLQILRLYTKKVPLDPSVKLETIAALCNGYVGADLEALCREATMCALKRSSNGITEATNVCNLSM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011397`
TK1151 ID	TkA02G610490
OH-1004 ID	LXL04_011397
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 99.190 / OH-1004 99.512 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011397

Location Chr02:163782334-163785352 (-)

Description Similar to CDC48B: Cell division control protein 48 homolog B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g03670`	Probably functions in cell division and growth processes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011397 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0015031 protein transport Biological Process

GO:0030154 cell differentiation Biological Process

GO:0042273 ribosomal large subunit biogenesis Biological Process

GO:0051301 cell division Biological Process

GO:0090069 regulation of ribosome biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005819 spindle Cellular Component

KEGG gene cross-reference

afu:AF_1297

ath:AT2G03670

hsa:166378

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.395

Rank 1 · LXL04_011397 · OH-1004

Peroxisome0.328

Rank 2 · LXL04_011397 · OH-1004

Cytoplasm0.157

Rank 3 · LXL04_011397 · OH-1004

Plastid0.097

Rank 4 · LXL04_011397 · OH-1004

Nucleus0.077

Rank 5 · LXL04_011397 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13191.13AAA_1651-124 aa

PF00004.36AAA54-189 aa

PF17862.8AAA_lid_3213-251 aa

PF06068.20TIP49323-377 aa

PF00004.36AAA325-457 aa

PF17862.8AAA_lid_3480-525 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011397	`PF13191.13`	AAA_16	51	124	5.4e-13	50.5
LXL04_011397	`PF00004.36`	AAA	54	189	5.9e-78	260.4
LXL04_011397	`PF17862.8`	AAA_lid_3	213	251	4.4e-32	109.9
LXL04_011397	`PF06068.20`	TIP49	323	377	6.1e-09	36.2
LXL04_011397	`PF00004.36`	AAA	325	457	5.9e-78	260.4
LXL04_011397	`PF17862.8`	AAA_lid_3	480	525	4.4e-32	109.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZPR1`	Arabidopsis thaliana	Cell division control protein 48 homolog B	74.549%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card